Examining the effect of depleting TUT4 and TUT7 on miRNA abundance in mouse embryonic fibroblasts

To examine the effect of depleting TUT4 and TUT7 on miRNA abundance in mouse embryonic fibroblasts (MEFs)，Dicer+/fl MEFs were transfected with 20 nM of siTUT4 and 10 nM of siTUT7 or 30 nM of non-targeting control siRNA using Lipofectamine RNAiMax (Life Technologies) twice (on Day 0 and Day 2) before MEFs were collected 4 days post transfection. 20-30 nt small RNAs were gel purified from total RNAs and sequentially ligated to Linker-1 (IDT) and 5' adaptor. The ligated products were amplified with DSFP5 (AATGATACGGCGACCACCGACTATGGATACTTAGTCAGGGAGGACGATGCGG) and Linker 1-RT (CAAGCAGAAGACGGCATACGAATTGATGGTGCCTACAG), and sequenced by Hi-Seq 2000 (Illumina). Raw reads were trimmed from the 3’end to remove low-quality bases as described in the BWA program (Li and Durbin, 2009). The 3’ adaptor was clipped using cutadapt with a 0.25 acceptable error rate. Reads that match transfected siRNAs, shorter than 15 nts or without 3’ adaptor were excluded from further analyses. Filtered reads were aligned to the mouse (mm9) genome using the BWA program (Li and Durbin, 2009). A single mismatch was allowed for the first 18 nts and a maximum of 10 mismatches for the whole read. Different libraries were normalized by upper quartile normalization.