Candidate human REV3L exon-26 siRNA: sequence, design and validation

Candidate human REV3L-targeting siRNA sequence record. TargetGene: REV3L (REV3 like, DNA directed polymerase zeta catalytic subunit)RefSeq transcript: NM_001372078.1 (transcript variant 4)Mapping: exon 26; transcript positions 8586–8606 (1-based, inclusive) Sequences (5′→3′)mRNA-matching/sense sequence: UGUUCACAAAGCCAGAGAGACReverse-complement antisense/guide sequence: GUCUCUCUGGCUUUGUGAACA The mRNA-matching sequence was verified by exact alignment to NM_001372078.1. NCBI RefSeq annotation places positions 8586–8606 within exon 26 (8572–8681). Current statusThis is a candidate siRNA. Duplex overhangs, chemical modifications, manufacturer and synthesis information are not yet reported. A formal off-target analysis has not yet been performed. Experimental knockdown validation data are not yet available. This record should not be interpreted as independent validation or peer review. If validation data are added later, the experimental conditions and raw qPCR or Western-blot data should be included in a new version.