qPCR before and after bleaching and after symbiont switing in the foraminifera Sorites orbiculus

The uptake of novel Symbiodiniaceae strains in Sorites orbiculus was measured using qPCR. To facilitate novel algae uptake, the specimens were bleached for 27 days with 0.19 mmol L-1 menthol and 5 µmol L-1 DCMU, followed by 19 days of re-inoculation with the Symbiodinium microadriaticum (strains KB8 and CCMP2467) and Fugacium kawagutii (strain F2) individually and collectively at a concentration of 1e5 cells ml-1 and a further observation for 37 days to verify long-term establishment of symbiosis. The primer pairs S.S.ITS2F (5′- TTCTGCTGCTCTTGTTATCAGG− 3′) and S.S.ITS2R (5′- ACACACATGAGCTTTTGTTTCG− 3′) were used and qPCR measurements were performed before the start of the experiment, after the bleaching experiment and after the symbiosis stability evaluation.