Grazing exclusion-induced changes in soil fungal communities in a highly desertified Brazilian dryland (Arbuscular mycorrhizal community)

This genomic sequencing data was generated using the primers NS31 (TTGGAGGGCAAGTCTGGTGCC) (Simon et al., 1992) and reverse primer AML2 (GAACCCAAACACTTTGGTTTCC) (Lee et al., 2008), which target a region specific to this microbial classification within the small-subunit ribosomal region. For the second reaction, the primers used were AMV4.5NF (CGAAATTCAACTACGAGCTT) and AMDGR (ATGATTAATAGGGATAGTTGGG) (Sato et al., 2005).