TABLE 1 in A new species of planthopper in the genus Bothriocera (Hemiptera: Auchenorrhyncha: Cixiidae) from coconut palm (Cocos nucifera) in Jamaica

TABLE 1. Primers used to amplify corresponding gene regions used to assess the placement of novel taxon and PCR parameters for each locus.
LocusPrimerDirectionSequence (5’ 3’)AnnealingExtensionReferenceCOICOI_D1_FForwardGGAACWATAAGAAGWATAATYATYCG40˚C1 min. 30 sec.Humphries et al. 2021C1-J-2195RCReverseACTTCTGGATGACCAAAAAATCAA18S18SfullforwardForwardGGATAACTGTGGTAATTCTAG50˚C2 min.Urban & Cryan 201218SRReverseGTCCGAAGACCTCACTAAABahder et al. 2019H3H3F2ForwardGKAARTCSACCGGHGGHAARGC55˚C30 sec.This studyH3RReverseGTKACHCKCTTRGCGTGRATEchavarria et al. 202128SVForwardGTAGCCAAATGCCTCGTCA55 ˚C1 min. 30 sec.Urban & Cryan 2012XReverseCACAATGATAGGAAGAGCC