Environmental DNA metabarcoding to monitor tropical reef fishes in Providencia island
收藏资源简介:
Environmental DNA (eDNA) provides a revolutionary method to monitor species in marine ecosystems from animal DNA present in the water. Examining the capacity of eDNA to provide accurate biodiversity measures in species-rich ecosystems such as coral reefs is a prerequisite for their long-term monitoring. Here, we surveyed a Colombian tropical marine reefs, Providencia Island using eDNA method. We collected a large quantity of surface water (30 L per filter) above the reefs and applied a metabarcoding protocol using three different primer sets targeting the 12S mitochondrial DNA, specific to vertebrates, Actinopterygii and Elasmobranchii. The assignment of eDNA sequences to species using a public reference database allowed detecting the presence of 107 fish species, 106 genera and 73 families in Providencia. Methods eDNA field sampling, in situ filtration and treatment In Providencia, sampled 10 stations with two filtration replicates for a total of 20 water samples around the island from June 29th to July 15th, 2018. We sampled eDNA in-situ using a filtration device composed of a Athena® peristaltic pump (Proactive Environmental Products LLC, Bradenton, Florida, USA; nominal flow of 1.1 L.min−1), a VigiDNA® 0.22µM cross flow filtration capsule (SPYGEN, le Bourget du Lac, France) allowing to filter a large water volume and disposable sterile tubing for each filtration capsule. Two filtration replicates were performed in parallel on each side of a small boat, at each station, during 30 minutes corresponding to a water volume of 30 L of water. At the end of each filtration, the water inside the capsules were emptied, and the capsules were filled with 80 mL of CL1 Conservation buffer (SPYGEN, le Bourget du Lac, France) and stored at room temperature. We followed a strict contamination control protocol in both field and laboratory stages (Goldberg et al., 2016; Valentini et al., 2016). Each water sample processing included the use of disposable gloves and single-use filtration equipment. DNA extraction, amplification and high-throughput sequencing The DNA extraction, amplification and sequencing were performed in separate dedicated rooms, equipped with positive air pressure, UV treatment and frequent air renewal. Two extractions per filter were performed following the protocol of Pont et al. (2018), the two DNA samples were pooled before the amplification step. After the DNA extraction the samples were tested for inhibition following the protocol described in Biggs et al. (2015). If the sample was considered inhibited it was diluted 5-fold before the amplification. DNA amplifications were performed in a final volume of 25 μL, using 3 μL of DNA extract as the template. The amplification mixture contained 1 U of AmpliTaq Gold DNA Polymerase (Applied Biosystems, Foster City, CA), 10 mM Tris-HCl, 50 mM KCl, 2.5 mM MgCl2, 0.2 mM each dNTP, 0.2 μM of each primers, 4 µM human blocking primer for the “teleo” primers (Civade et al., 2016) and 0.2 µg/µL bovine serum albumin (BSA, Roche Diagnostic, Basel, Switzerland). We used three different primer sets, targeting chondrichthyans (Chon01, forward: -ACACCGCCCGTCACTCTC, reverse - CATGTTACGACTTGCCTCCTC), teleosteans (teleo/Tele01, forward: - ACACCGCCCGTCACTCT, reverse - CTTCCGGTACACTTACCATG) and more generally vertebrates (Vert01, forward: - TAGAACAGGCTCCTCTAG, reverse - TTAGATACCCCACTATGC) (Valentini et al., 2016; Taberlet et al., 2018). Mean markers lengths were between 44 bp for Chond01, 64 bp for teleo and 97 for Vert01. These three primers sets were 5’-labeled with an eight-nucleotide tag unique to each PCR replicate for teleo and unique to each sample for the other two primers pairs (with at least three differences between any pair of tags), allowing the assignment of each sequence to the corresponding sample during sequence analysis. The tags for the forward and reverse primers were identical. The PCR mixture was denatured at 95°C for 10 min, followed by 50 cycles of 30 s at 95°C, 30 s at 55°C for teleo and Vert01 and 58°C for Chon01 and 1 min at 72 °C and a final elongation step at 72°C for 7 min. Twelve replicates of PCRs were run per filtration, i.e., 24 per sampling site. After amplification, the samples were titrated using capillary electrophoresis (QIAxcel; Qiagen GmbH) and purified using the MinElute PCR purification kit (Qiagen GmbH). Before sequencing, purified DNA was titrated again using capillary electrophoresis. The purified PCR products were pooled in equal volumes to achieve a theoretical sequencing depth of 1 000,000 reads per sample. Three libraries were prepared using the MetaFast protocol (Fasteris, https://www.fasteris.com/dna/?q=content/metafast-protocol-amplicon-metagenomic-analysis). For two libraries a paired-end sequencing (2x125 bp) was carried out using an Illumina HiSeq 2500 sequencer on a HiSeq Rapid Flow Cell v2 using the HiSeq Rapid SBS Kit v2 (Illumina, San Diego, CA, USA) and on a MiSeq (2x125 bp, Illumina, San Diego, CA, USA) and the MiSeq Flow Cell Kit Version3 (Illumina, San Diego, CA, USA) were used following the manufacturer’s instructions. Library preparation and sequencing were performed at Fasteris (Geneva, Switzerland). Four negative extraction controls and two negative PCR controls (ultrapure water, 12 replicates) were amplified per primer pair and sequenced in parallel to the samples to monitor possible contaminants.



