Comprehensive target DNA methylome analyses in young and aged mouse sperm
收藏资源简介:
Advanced paternal age has deleterious effects on mental health of next generation. To uncover the molecular basis for transgenerational influence of paternal aging, we investigated epigenetic changes in sperm. Target methylome analyses by SureSelect Methyl-Seq, Agilent Technology was conducted using 4 young (3-month-old) and 9 aged (18-month-old) sperm in mouse. We analyzed DNA methylated regions (DMRs) using the Model-based Analysis of Bisalfite Sequence (MOABS) and identified 16 hyper- and 96 hypo-methylated unique DMRs in aged mouse sperm, suggesting that sperm aging induces hypo-methylation, rather than hyper-methylation, of the chromosomal DNA. Furthermore, we examined biological significance of the DMRs in aged sperm by bioinformatics analyses. Motif analysis revealed significant enrichment (P=1e-25) of a unique consensus sequence, GGAGCTGTCCATGGTGCTGA, which indicates potential binding to the RE1-silencing transcription factor, REST, or in other name, neuron-restrictive silencer factor (NRSF). These suggest that DNA hypo-methylation due to paternal aging in sperm would impact neurogenesis in next generation.



