Eukaryotic metagenome in Schizaphis graminum aphids

The eukaryotic microbial, predominantly fungal metagenome in greenbug (Schizaphis graminum) aphids was investigated in response to aphid biotype, host species, host cultivar, and time post infestation. The ribosomal ITS1-ITS2 hypervariable region was amplified from whole aphids, sequenced, and characterized against eukaryotic 18S sequences. Greenbug biotypes E and K were placed on potted plants of 17 accessions/cultivars in growth chambers. The accessions were: A1, Aegilops triuncialis TA1675 (Gbz), A2, Ae. triuncialis TA1695 (Gbx1); B1 to B2, barley cultivars Wintermalt, Jao (RSg1), and Post90; R1 and R2, rye cultivars Elbon and Insave F.A. (Gb2 amd Gb6); S1 to S4, sorghum cultivars TX7000, TX2737, TX2783, and DZhugara Belaya (PI 550607); and W1 through W6, wheat cultivars Newton, Custer, Amigo, Largo, C117882, and GRS 1201. Whole aphids were sampled by freezing in liquid nitrogen immediately before placement and 2, 4, and 8 days after placement. DNA was extracted using the DNeasy Blood and Tissue Kit for DNA Isolation (Qiagen, Germantown, MD) following its instructions. PCR was performed with forward primer ITS1F (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2R (GCTGCGTTCTTCATCGATGC), which expectedly amplify a 314-base fragment. The libraries were barcoded, pooled, and sequenced on an Illumina Novaseq to generate 2x250-base paired-end reads. Demultiplexed reads were returned as fastq files with the biotype, host species, host cultivar, time point, and replicate encoded in each file name as BSC_TR, where B is biotype E or K; S is A (Aegilops triuncialis), B (barley), R (rye), S (sorghum), or W (wheat); C is a number from 1 to 6 for the cultivar as listed above; T is a number from 0 to 3 as 0, 2, 4, or 8 days; and R is biological replicate 1 to 3. This data set adds to knowledge of eukaryotic microfloras in the group of related genera (Aphis, Rhopalosiphum) to which Schizaphis belongs.