Comprehensive analysis of genomic G-quadruplex forming oligonucleotides homologous to NHEIII1 of c-MYC promoter on leukemia cell growth inhibition and c-MYC expression

The c-MYC onco-protein regulates a large array of genes playing an important role in basic cell functions. Because of its central role in growth regulation, c-MYC expression must be tightly regulated. The NHEIII1 located upstream of the P1 promoter regulates up to 80% of c-MYC transcription, and includes a C/G rich region (Pu27) which forms a G-quadruplex structure. We have identified seventeen genomic G-quadruplex-forming motifs which have more than 90% identity with Pu27 found on different chromosomes throughout the human genome. Of thirteen members of the Pu27 family tested, all interact specifically with NHEIII1 sequence and inhibit leukemic cells proliferation to differing degrees. Further characterization of three Pu27 homologous sequences (Pu5-, Pu9- and Pu27) reveals a dose/time dependent response on growth inhibition in four leukemia cell lines and down regulation of c-MYC at RNA and protein level. The three Pu27 family members selectively alter expression of genes involved in cell cycle progression/regulation, DNA damage/repair and histone modification. In conclusion, we have identified sixteen genomic G-quadruplex-forming sequences homologous to Pu27 of c-MYC promoter sharing the same structure and function. It is likely that these sequences play important biologic roles in c-MYC regulation and provide an ideal tool for targeted cancer therapy. A total of 39 samples were hybridized, representing triplicates with untreated (unt) at 0h, 24h, 48h, and 72h, and three (3) oligonucleotide treatments: Pu27, Pu9-, and Pu5- at three (3) timepoints: 24h, 48h, and 72h (3+3x3x4=39). This includes: Untreated (wild type) at 0, 24, 48, and 72 hr; Treated with the Pu5- oligonucleotide sequence TGGGGAGGGTGGGGAGGGTGGTGAGGGTGGGGAGGGGGAAGG at 24, 48, and 72hr; Treated with the Pu9- oligonucleotide sequence GGGTGGGGAGGGTGGGGAAG at 24, 48, and 72hr; and Treated with the Pu27 oligonucleotide sequence TGGGGAGGGTGGGGAGGGTGGGGAAGG at 24, 48, and 72hr. The complete data matrix including control probes (49,495 data rows) is included as a Series supplementary file.