Table 1 in Hiding in the mists: molecular phylogenetic position and description of a new genus and species of snake (Dipsadidae: Xenodontinae) from the remote cloud forest of the Lost World
收藏资源简介:
Table 1. Primers and PCR conditions. LocusGene typePrimer nameSequence (5 ʹ – 3 ʹ)Annealing temperature (° C)Primer source16 SaMitochondrialForward: L 2510CCGACTGTTTAMCAAAAACA54Palumbi et al. (1991)Reverse: H 3056CTCCGGTCTGAACTCAGATCACGTAGG54Hedges (1994)12 SaMitochondrialForward: L 1091 modCAAACTAGGATTAGATACCCTACTAT51Kocher et al. (1989)Reverse: H 1157 modGTACRCTTACCWTGTTACGACTT51Knight and Mindell (1994)cytb bMitochondrialForward: 703 Botp. modTCAAAYATCTCAACCTGATGAAAYTTYGG54Pook et al. (2000)Reverse: MVZ 16 p. modGGCAAATAGGAAGTATCAYTCTGGYTT54Pook et al. (2000)ND 4 bMitochondrialForward: ND 4TGACTACCAAAAGCTCATGTAGAAGC50Forstner et al. (1995)Reverse: LEUTACTTTTACTTGGATTTGCACCA50Forstner et al. (1995)BDNF bNuclearForward: BDNFFGACCATCCTTTTCCT ḎCTATGGTTATTTCATACTT54Leaché and McGuire (2006)Reverse: BDNFRCTATCTTCCCCTTTTAATGGTCAGTGTACAAAC54Leaché and McGuire (2006)c-mos bNuclearForward: S 77CATGGACTGGGATCAGTTATG50Lawson et al. (2005)Reverse: S 78CCTTGGGTGTGATTTTCTCACCT50Lawson et al. (2005) a 96 ° C for 3 min; 40 × 95 °C for 30 s, annealing for 60 s, 72 ° C for 1 min; 1 × 72 ° C for 10 min. b 94 ° C for 4 min; 40 × 94 °C for 60 s, annealing for 60 s, 72 ° C for 1 min; 1 × 72 ° C for 10 min.



