Response to immune checkpoint blockade improved in pre-clinical model of breast cancer after bariatric surgery
收藏NIAID Data Ecosystem2026-03-13 收录
下载链接:
http://datadryad.org/dataset/doi%253A10.5061%252Fdryad.w0vt4b8tq
下载链接
链接失效反馈官方服务:
资源简介:
Bariatric surgery is becoming more prevalent as a sustainable weight loss approach, with vertical sleeve gastrectomy (VSG) being the first line of surgical intervention. We and others have shown that obesity exacerbates tumor growth while diet-induced weight loss impairs obesity-driven progression. It remains unknown how bariatric surgery-induced weight loss impacts cancer progression or alters responses to therapy. Using a pre-clinical model of diet induced obesity followed by VSG or diet-induced weight loss, breast cancer progression and immune checkpoint blockade therapy was investigated. Weight loss by bariatric surgery or weight matched dietary intervention before tumor engraftment protected against obesity-exacerbated tumor progression. However, VSG was not as effective as dietary intervention in reducing tumor burden despite achieving similar extent of weight and adiposity loss. Circulating leptin did not associate with changes in tumor burden. Uniquely, tumors in mice that received VSG displayed elevated inflammation and checkpoint ligand PD-L1. Further, mice that received VSG had reduced tumor infiltrating T lymphocytes suggesting an ineffective anti-tumor microenvironment. VSG-associated elevation of PD-L1 prompted us to next investigate the efficacy of immune checkpoint inhibitors in lean, obese, and formerly obese mice that lost weight by VSG or weight matched controls. While obese mice were resistant to immunotherapy, anti-PD-L1 potently impaired tumor progression after VSG through improved anti-tumor immunity. Thus, in formerly obese mice, surgical weight loss followed by immunotherapy reduced breast cancer burden. Further studies are necessary to determine how bariatric surgery sensitizes tumors to immune checkpoint inhibition.
Methods
Mice and diets. Animal studies were performed with approval and in accordance with the guidelines of the Institutional Animal Care and Use Committee (IACUC) at the University of Tennessee Health Science Center (Animal Welfare Assurance Number A3325-01) and in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. The protocol was approved under the protocol identifier 21.0224. All animals were housed in a temperature-controlled facility with a 12-h light/dark cycle and ad libitium access to food and water, except where indicated. Three-week-old female C57BL/6J (Jackson stock number: 000664) mice were shipped to UTHSC and acclimated 1 week. Four-week-old mice were randomized to either obesogenic high fat diet (HFD, D12492i – 60% kcal derived from fat) or low fat diet (LFD, D12450Ji- 10% kcal derived from fat) from Research Diets Inc. (New Brunswick, NJ) for 16 weeks (age 4 weeks to 20 weeks old, study design Figure 1A). Mice resistant to diet induced obesity (DIO), as defined by less than 28 grams after 16 weeks of HFD, were excluded from the study. DIO mice received either a bariatric surgery or sham control surgery and dietary intervention as described below.
Body weight and composition. Body weight was measured 2x/week. Body composition including lean mass, fat mass, free water content, and total water content of non-anesthetized mice was measured weekly using EchoMRI-100 quantitative magnetic resonance whole body composition analyzer (Echo Medical Systems, Houston, TX).
Vertical Sleeve Gastrectomy. To reduce bariatric surgery-associated weight loss, peri-operative measures included providing liquid diet (Ensure® Original Milk Chocolate Nutrition Shake, Abbott, Chicago, IL) and DietGel recovery (Clear H2O, Portland, ME, ID# 72-06-5022) one day before surgery to all mice. Four hours before surgery, solid food was removed to reduce stomach contents. For 4 hours pre-surgery, mice were maintained half on half off a heat pad in clean new cages. Surgery was performed under isoflurane anesthesia. Vertical sleeve gastrectomy (VSG) was performed as previously described [34] with additional control dietary intervention for comparison of weight loss approaches. The stomach was clamped and the lateral 80% of the stomach was removed with scissors. The remaining stomach was sutured with 8-0 to create a tubular gastric sleeve. All treatment groups not receiving VSG had a sham surgery performed. For sham, an abdominal laparotomy was performed with exteriorization of the stomach. Light pressure with forceps was applied to the exteriorized stomach. For both VSG and sham surgeries, the abdominal wall was closed with 6-0 sutures and skin closed with staples. Mice received carprofen (5mg/kg, subcutaneous, once daily) as an analgesic immediately prior to and once daily for 3 days following surgery. Mice were given 1ml saline at time of surgery. Perioperative procedures were performed in accordance with the literature [86, 87]. For 12 hours post-surgery, mice were maintained half on half off a recovery heat pad. Mice were provided Ensure® liquid diet (as above), DietGel recovery, and solid food pellets ad libitum for 48 hours post-surgery. HFD-fed DIO mice receiving VSG (“HFD-VSG”) were maintained on the same HFD for 5 weeks following surgery until euthanasia at study endpoint (Figure 1A). Control groups that were lean (“LFD-Sham”) or DIO (“HFD-Sham”) were maintained on respective LFD or HFD diets following sham surgery. For dietary intervention weight loss, DIO mice received sham surgery and were subjected to weight loss intervention following sham surgery for 5 weeks until endpoint. “Weight Matched” (WM) mice were controls to the HFD-VSG mice by weight matching through restricting intake of HFD [88]. On average, mice consumed 1.7g (ranging from 1.0-2.5 g or 8.84 kcal (5.2-13.0 kCal) per day of HFD. Mice were fed at the start of the dark cycle. 78.9% of VSG mice survived to endpoint (30/38).
Tumor cell implantation. E0771 murine adenocarcinoma breast cancer cell line was originally isolated from a spontaneous tumor from C57BL/6 mouse. E0771 cells were purchased from ATCC (CRL-3461) and stable transfected to express luciferase (luc) [85] by the Korkaya group at Augusta University [52, 85]. Cells were cultured as described previously [52]. Briefly, cells were cultured in RPMI containing 10% FBS, 100 UI/mL of penicillin, and 100 μg/ml streptomycin in a humidified chamber at 37°C under 5% CO2. E0771 cells were injected in the left fourth mammary fat pad of 22-week-old C57BL/6J females at 250,000 cells in 100μl of 75% RPMI / 25% Matrigel. When tumors became palpable (typically one week after implantation), tumor growth was monitored 2x/week by measuring the length and width of the tumor using digital calipers. Tumor volume was calculated using the following formula: Volume = (width)2 × (length)/2 [52]. No tumors failed to take, and tumor regression was not detected. At the endpoint on day 21 after tumor cell injection, excised tumor mass was determined.
Immune checkpoint blockade. In a separate experimental cohort limited to HFD-VSG and controls including LFD-Sham, HFD-Sham, and WM-Sham, mice were subjected to the same dietary and surgical study design above (Figure 1A). After 20 weeks on LFD or HFD, 24-week-old mice received either a sham or VSG surgery. Two weeks following surgery, mice were injected with E0771-luc cells as above. Immune checkpoint blockade (ICB) included anti PD-L1 antibody (Clone 10F.9G2, #BE0101) and IgG2b isotype control (Clone LTF-2, #BE0090), purchased from BioXcell (West Lebanon, NH). Antibody administration by intraperitoneal (i.p.) injection began three days after E0771 cell injection when tumors were palpable (width of >2.5mm). Mice were injected every third day for 21 days until endpoint (8mg/kg) [89].
Tissue and blood collection. Three weeks after tumor implantation (i.e., five weeks after surgery), mice were fasted for 4 h and anesthetized. Blood was collected via cardiac puncture into EDTA-coated vials. Plasma was separated from other blood components by centrifugation at 1200×g for 45 min at 12°C. Mammary tumors, tumor adjacent mammary fat pad, unaffected inguinal mammary fat pad, and gonadal adipose were weighed and either flash frozen in liquid nitrogen, placed into a cassette and formalin-fixed, or digested into a single cell suspension for flow cytometry. All frozen samples were stored at −80°C until analyzed.
Plasma adipokines and cytokines. Plasma collected at sacrifice was used for measuring leptin and IL-6 using the Milliplex MAP Mouse Metabolic Hormone Magnetic Bead Panel in the Luminex MAGPIX system (EMD Millipore, Billerica, MA).
Flow cytometric analysis of tumors and adjacent mammary adipose tissue. Flow cytometry analysis was done as previously described [52]. In brief, excised tumors (200 mg) were dissociated in RPMI media containing enzyme cocktail mix from the mouse tumor dissociation kit (Miltenyi Biotec, Auburn, CA) and placed into gentleMACS dissociators per manufacturer’s instructions. Spleen single cell suspensions were obtained by grinding spleens against 70μm filter using a syringe plunger. Following red blood cell lysis (Millipore Sigma, St. Louis, MO), viability was determined by staining with Ghost dye (Tonbo Biosciences Inc.) followed by FcR-blocking (Tonbo). Antibodies were titrated, and separation index was calculated using FlowJo v. 10 software. Cells were stained with fluorescently labeled antibodies and fixed in Perm/fix buffer (Tonbo). Stained cells were analyzed using Bio-Rad ZE5 flow cytometer. Fluorescence minus one (FMO) stained cells and single color Ultracomp Beads (Invitrogen, Carlsbad CA) were used as negative and positive controls, respectively. Data were analyzed using FlowJo v 10 software (Treestar, Woodburn, OR). Total immune cells from tumor and tumor adjacent mammary fat pad (including tumor draining lymph node, TdLN) were gated by plotting forward scatter area versus side scatter area, single cells by plotting side scatter height versus side scatter area, live cells by plotting side scatter area versus Ghost viability dye, and immune cells by plotting CD45 versus Ghost viability dye. T cells were gated as follows in tumor CD3+ T cells (CD3+), and CD8+ T cells (CD3+, CD8+). Macrophages are gated as CD11b+, F480+. Monocytic myeloid derived suppressor cells (M-MDSC) are gated as CD11b+ Ly6Chigh, Ly6G-. Non-immune cells were gated as CD45- and mean fluorescent intensity (MFI) for PD-L1. Gates were defined by FMO stained controls and verified by back-gating of cell populations. Gating schema is shown supplemental file 2.
Flow cytometric analysis of E0771 breast cancer cells. E0771-luc cells were treated with recombinant mouse IL-6 (200pg/mL) for four hours. Representative biological replicate plotted, with N=3 biological replicates with significance. Following trypsinization, cells were stained with Ghost dye (Tonbo Biosciences Inc.) followed by FcR-blocking (Tonbo) and fluorescent PD-L1 antibody. Flow cytometry performed and analyzed as above for PD-L1 MFI.
RNA sequencing (RNA-seq). mRNA was extracted from tumor tissue using RNeasy mini kit (QIAGEN, Germantown, MD) and mammary fat pad tissue using a kit specific for lipid rich tissue (Norgen Biotek, Ontario, Canada). The integrity of RNA was assessed using Agilent Bioanalyzer and samples with RIN >8.0 were used. Libraries were constructed using NEBNext® Ultra™ RNA Library Prep Kits (non-directional) for Illumina, following manufacturer protocols. mRNA was enriched using oligo-dT beads. Libraries were sequenced on NovaSeq 6000 using paired-end 150 bp reads. There was no PhiX spike-in. Data was analyzed as described previously [52, 90]. RNA-seq statistical differences between experimental groups were determined as described previously [52]. In brief, Benjamini-Hochberg procedure was used to control false discovery rate (FDR) for adjusted P value. RNA-seq data has been uploaded as GEO GSE174760, GSE174761, and GSE174762. Transcript-level abundance was imported into gene-level abundance with the R package tximport. Genes with low expression were identified and filtered out from further analysis using filterByExpr function of the edgeR package in R software. Voom transformation function was applied to normalize log2-cpm values using mean-variance trend in the limma software package. ClaNC was used to create classifier genes that characterize the groups of interest for semi-supervised heatmaps. Database for Annotation, Visualization and Integrated Discovery (DAVID) v6.8 was used for pathway analysis [91]. Immune infiltration estimations based on bulk gene expression data from RNA-seq was plotted using TIMER2.0 [92] and cell-type identification estimating relative subsets of RNA transcripts (CIBERSORT) [93].
Bariatric Surgery Patient RNA-seq. Patient gene expression from subcutaneous adipose tissue pre- and post- bariatric surgery was downloaded from GSE65540 [43] and counts were normalized using counts per million (CPM). EdgeR was used for differential expression analysis and significance was defined as adjusted p-value of < 0.1. Benjamini-Hochberg was used to calculate the FDR. Mouse and human Venn diagram was created using the interactive Venn website.
Gene expression. Total RNA was isolated from tumors and reversed transcribed to cDNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qRT-PCR was performed with iTaq Universal SYBR Green Supermix (Bio-Rad). Primers span an exon-exon junction and were designed with Primer-BLAST (NCBI). Relative gene expression was calculated normalized to 18S transcript with 2–∆∆Ct. Primer sequences are:
Ifng F:GGATGCATTCATGAGTATTGC, Ifng R:GTGGACCACTCGGATGAG,
Prf1 F:GAGAAGACCTATCAGGACCA, Prf1 R:AGCCTGTGGTAAGCATG,
Gzmb F:CCTCCTGCTACTGCTGAC, Gzmb R:GTCAGCACAAAGTCCTCTC,
18S F: TTCGGAACTGAGGCCATGATT, 18S R:TTTCGCTCTGGTCCGTCTTG
Histology and quantification. Tumors and normal 4th mammary fat pads, (contralateral to the injected tumor bearing mammary fat pad) were isolated at the time of sacrifice and fixed in 10% formalin. Formalin fixed paraffin embedded (FFPE) sections from tumors and adipose were cut at 5 µm thickness. FFPE sections were stained with Hematoxylin and Eosin and scanned by Thermo Fisher (Panoramic 250 Flash III, Thermo Fisher, Tewksbury, MA) scanner and adipocyte area of N=50 adipocytes were quantified using software (Case Viewer) along the longest diameter per adipocyte.
Statistics. Statistical differences between experimental groups were determined using One-way or Two-way ANOVA (as noted in figure legends) with Fisher’s LSD test for individual comparisons. Outliers were identified and excluded based on the ROUT method with Q=1%. For body weight, body composition, and tumor volume over time within animals, data was treated as repeated measures. All statistics were performed using statistical software within Graphpad Prism (Graphpad Software, Inc., La Jolla CA). All data are shown as mean ± standard error of the mean (SEM). P values less than 0.05 were considered statistically significant. Sample size was determined by power analysis calculations and pilot experiments. Group allocation was done to ensure equal distribution of starting body weight between groups.
Study approval. Animal studies were performed with approval and in accordance with the guidelines of the Institutional Animal Care and Use Committee (IACUC) at the University of Tennessee Health Science Center and in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals.
创建时间:
2022-07-18



