Table 1 in Pseudechiniscus in Japan: re-description of Pseudechiniscus asper Abe et al., 1998 and description of Pseudechiniscus shintai sp. nov.

Table 1. Primers and references for specific protocols for amplification of the four DNA fragments sequenced in the study. DNA fragmentPrimer namePrimer directionPrimer sequence (5 ’-3’)Primer sourcePCR programme*18S rRNA18S_Tar_Ff1forwardAGGCGAAACCGCGAATGGCTCStec et al. (2017)Zeller (2010)18S_Tar_Rr2reverseCTGATCGCCTTCGAACCTCTAACTTTCGGąsiorek et al. (2017)28S rRNA28S_Eutar_FforwardACCCGCTGAACTTAAGCATATGąsiorek et al. (2018b)Mironov et al. (2012)28SR0990reverseCCTTGGTCCGTGTTTCAAGACMironov et al. (2012)ITS-1ITS1_Echi_FforwardCCGTCGCTACTACCGATTGGGąsiorek et al. (2019)Wełnicz et al. (2011)ITS1_Echi_RreverseGTTCAGAAAACCCTGCAATTCACGCOIbcdF01forwardCATTTTCHACTAAYCATAARGATATTGGDabert et al. (2008)Wełnicz et al. (2011)bcdR04reverseTATAAACYTCDGGATGNCCAAAAAA * - All PCR programmes are also provided in Stec et al. (2015).