PRJNA20250806

Sludge samples were taken for Illumina sequencing at 7 and 30 d, respectively, and there was a difference in the MNZ concentrations taken for MD (0, 10, 100 mg/L) and TD (0, 50, 100 mg/L). DNA fragments of the communities were quantified using Nanodrop and then paired-end sequenced using Illumina. Primers 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT) targeting the V3-V4 regions (468 bp) of the bacterial 16S rRNA gene were used. Sequence denoising or OTU clustering was performed according to the Quantitative Insights Into Microbial Ecology 2 (QIIME2) dada2 analysis process.