Keskin_AmpliconSequencingFis1TA

A pool of plasmids containing Fis1p TA mutations in a Gal4-sfGFP-Fis1 fusion protein and constructed using degenerate primers was cultured in strain MaV203 for four generations in SC-Trp medium, SC-Ura medium, or SMM-Trp-His medium containing 0 mM, 5 mM, 10 mM, or 20 mM 3-AT. Plasmids present under each culture condition were then recovered from 10 OD600 units of cells. Primers 882 (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGTAGAGGATAAGATCCAGAAGGAAAC) and 883 (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCATAAGAAATTCGCTTATTTAGAAGTG) were used to amplify the genomic region encoding the Fis1p TA from each plasmid pool. Using the provided PCR products, next-generation, paired-end sequencing was performed by Microsynth (Balgach, Switzerland) on a MiSeq Nano (2x150v2). GZIP-compressed FASTQ files and a commercial sequencing report are found in the associated ZIP file.