Peatland fungal communities studied by metabarcoding in north-western Siberia

In order to study the fungal community of raised bogs, four major substrates were subjected to metabarcoding analysis: peat (from the surface layer to about 3 m depth), plant litter (6 plant species), wood (standardised wooden dowels) and mycorrhizal roots (Pinus sylvestris L., P. sibirica Du Tour). Six plots were located alongside the walking board of the Mukhrino field station research polygon in two habitats: treed Pine-dwarf-shrubs-Sphagnum bogs and graminoid-Sphagnum hollows. For each of the substrate groups, we designed the experiment to cover spatial and temporal variability, substrate features and methodological questions related to sample size, storage and homogenisation approaches. A total of 285 samples of environmental DNA, extracted from four substrates, were obtained and stored at -20C until being processed. The study sites are the Mukhrino field station and the Mukhrino Bog, which are located in the middle taiga zone of Western Siberia, near the regional capital city of Khanty-Mansiysk (60.89N, 68.68E). The samples of extracted DNA were outsourced for processing by an independent company (Evrogen, Moscow). The quality of the obtained metagenomic DNA was checked by electrophoresis on an agarose gel. Quantification was carried out by measuring the concentration of DNA by Qubit 2, using the dsDNA HS reagent kit (ThermoFisher Scientific). The preparation of libraries for sequencing was carried out in accordance with the protocol described in 16S Metagenomic Sequencing Library Preparation (Part 15044223 Rev. B; Illumina). Amplification of ITS variable regions was carried out using primers: fITS7: GTGARTCATCGAATCTTTG and ITS4: TCCTCCGCTTATTGATATGC (White et al. 1990, Ihrmark et al. 2012). After obtaining the amplicons, the libraries were purified and pooled equimolarly with the SequalPrep Normalization Plate Kit (ThermoFisher, Cat A10510-01). Quality control of the libraries was carried out using the Fragment Analyzer and quantitative analysis was carried out with qPCR. The library was sequenced on Illumina MiSeq (length of reads - 300 bp on both side fragments) using MiSeq Reagent Kit v.3 (600 cycles). FASTQ files were obtained using bcl2fastq v.2.17.1.14 Conversion Software (Illumina). The PhiX phage library was used to control sequencing parameters. Most of the readings related to phage DNA were removed during demultiplexing. For more information, read a published data-paper: Filippova N, Zvyagina E, Rudykina EA, Ishmanov TF, Filippov IV, Bulyonkova TM, Dobrynina AS (2024) DNA-based occurrence dataset on peatland fungal communities studied by metabarcoding in north-western Siberia. Biodiversity Data Journal 12: e119851. https://doi.org/10.3897/BDJ.12.e119851