five

Inflammatory osteolysis is regulated by site-specific ISGylation of the scaffold protein NEMO

收藏
NIAID Data Ecosystem2026-03-11 收录
下载链接:
http://datadryad.org/dataset/doi%253A10.5061%252Fdryad.tx95x69tn
下载链接
链接失效反馈
官方服务:
资源简介:
Inflammatory osteolysis is governed by exacerbated osteoclastogenesis. Ample evidence points to central role of NF-kB in such pathologic responses, yet the precise mechanisms underpinning specificity of these responses remain unclear. We propose that motifs of the scaffold protein IKKg/NEMO partly facilitate such functions. As proof-of-principle, we used site-specific mutagenesis to examine the role of NEMO in mediating RANKL-induced signaling in bone marrow macrophages, known as osteoclast precursors. We identified lysine (K)270 as a target regulating RANKL signaling as K270A substitution results in exuberant osteoclastogenesis in vitro and inflammatory osteolysis in vivo. Mechanistically, we discovered that K270A mutation disrupts autophagy, stabilizes NEMO, and elevates inflammatory burden. Specifically, K270A directly or indirectly hinders binding of NEMO to ISG15, a ubiquitin-like protein, which we show targets the modified proteins to autophagy-mediated lysosomal degradation. Taken together, our findings suggest that NEMO serves as a toolkit to fine-tune specific signals in physiologic and pathologic conditions. Methods Material and methods: Key Resources Table Reagent type Designation Source or reference Identifiers Additional information Strain (Mus musculus) Nemo-floxed (NM-f/f) Dr. Manolis Pasparakis (Cologne, Germany)   C57BL/6 background Strain (Mus musculus) NEMO-K270A-floxed  Mouse Genetics Core, Washington University (St. Louis, MO)   C57BL/6 background Strain (Mus musculus) NEMO-WT-Tg-floxed  Mouse Genetics Core, Washington University (St. Louis, MO)   C57BL/6 background Strain (Mus musculus) LysozymeM-cre The Jackson Laboratory (Bar Harbor, ME, USA)   C57BL/6 background Strain (Mus musculus) ISG15 knockout Dr. Lenschow, Washington University (St. Louis, MO)   C57BL/6 background Recombinant DNA reagent (plasmid) pMX- retroviral vector Cell biolabs, San Diego, CA Catalog number RTV-010 Mouse retrovial vector Recombinant DNA reagent (plasmid) pMX-GFP This paper   Mouse retrovial vector Recombinant DNA reagent (plasmid) pMX-flag-NEMO-WT This paper   Mouse retrovial vector Recombinant DNA reagent (plasmid) pMX-flag-NEMO-K270A-RFP This paper   Mouse retrovial vector Recombinant DNA reagent (plasmid) pMX-flag-NEMO-D304N This paper   Mouse retrovial vector Recombinant DNA reagent (plasmid) pMX-flag-NEMO-K319A This paper   Mouse retrovial vector Recombinant DNA reagent (plasmid) pMX-flag-NEMO-WT-GFP This paper   Mouse retrovial vector Recombinant DNA reagent (plasmid) pMX-HA-ISG15 This paper   Mouse retrovial vector Recombinant DNA reagent (plasmid) pMX-flag-NEMO-WT-ISG15-GFP This paper   Mouse retrovial vector Recombinant DNA reagent (plasmid) pMX-flag-NEMO-K270A-ISG15-GFP This paper   Mouse retrovial vector Recombinant DNA reagent (plasmid) PMRX-GFP-LC3-RFP retrovirus AddGene, Watertwon, MA, USA Catalog number 84573 Rat species Recombinant DNA reagent (transfection reagent) Xtreme gene 9 Roche, San Francisco, CA, USA Catalog number 6365809001 Introduce plasmid into cells Cell line (human) PLAT-E Cell biolabs, San Diego, CA Catalog number RV-101 For generating retroviruses Commercial assay kit TRAP-Leukocyte kit Sigma, St Louis, MO, USA Catalog number 387A-1KT Identify osteoclasts Commercial assay kit RelA-luciferase activity luciferase assay system, GoldBio, St. Louis, MO Catalog number I920-50 NFkB activity assay Commercial assay kit Protein measurement BCA assay, Pierce, Invitrogen Catalog number 23227 Quantitation of protein Other (Buffer) Cell lysis buffer Cell Signaling Technology, Danvers, MA, USA Catalog number 9803S Western blot reagent Antibodies donkey anti-rabbit and anti-mouse LI-COR Biosciences, Lincoln, NE, USA P/N 926-32213 Secondary antibody for western blot Antibodies NEMO Santa Cruz, Dallas, TX, USA SC-8330 Rabbit/Mouse Antibodies LAMP-1 Santa Cruz, Dallas, TX, USA SC-20011 Mouse Antibodies  ISG15 Santa Cruz, Dallas, TX, USA SC-166755 Mouse Antibodies phos-p65 Cell Signaling Technology, Danvers, MA, USA Catalog number 3031 Rabbit Antibodies p65 Cell Signaling Technology, Danvers, MA, USA Catalog number 8242 Rabbit Antibodies LC3 Cell Signaling Technology, Danvers, MA, USA Catalog number 3868 Rabbit Antibodies Flag Sigma, St. Louis, MO, USA Catalog number F1804 Rabbit Antibodies  β-actin Sigma, St. Louis, MO, USA Catalog number A2228 Mouse Antibodies anti-B220 eBioscience, BioLegend (San Diego, CA, USA) Catalog number RA3-6B2 Flow cytometry antibody Antibodies anti-CD3e eBioscience, BioLegend (San Diego, CA, USA) Catalog number 145-2C11 Flow cytometry antibody Antibodies anti-Gr1 eBioscience, BioLegend (San Diego, CA, USA) Catalog number 14-5931-82 Flow cytometry antibody Antibodies  anti-Ter119 BD Bioscience (San Diego, CA, USA) Catalog number 550565 Flow cytometry antibody Antibodies anti-Sca1 PerCP Cy5.5 eBioscience, BioLegend (San Diego, CA, USA) Catalog number 122523 Flow cytometry antibody Antibodies anti-c-Kit APC eFluor 780 eBioscience, BioLegend (San Diego, CA, USA) Catalog number 47-1171-82 Flow cytometry antibody Antibodies anti-CD34 FITC eBioscience, BioLegend (San Diego, CA, USA) Catalog number 343503 Flow cytometry antibody Antibodies  CD16/32 eFluor450 eBioscience, BioLegend (San Diego, CA, USA) Catalog number 48-0161-82 Flow cytometry antibody Antibodies colloidal gold conjugated secondary antibodies Jackson ImmunoResearch Laboratories, Inc., West Grove, PA Catalog number 715-205-150 Electron microscopy Antibodies Alexa Fluor secondary antibodies Invitrogen, Waltham, MA, USA   Immunofluorescence Commercial assay kit multiplex mouse cytokine kits R&D Systems, Minneapolis, MN, USA; AYR006 Inflammation markers Commercial assay kit multiplex mouse cytokine kits  Millipore, San Diego, CA, USA MCYTMAG-70K-PX32 Inflammation markers Commercial assay kit Serum cross‐linked telopeptide of type I collagen (CTX‐I) RatLaps (CTX-1) EIA, Immunodiagnostic Systems, Boldon, UK AC-06F1 bone resorption marker Commercial assay kit Mouse TRAP (TRAcP 5b) kits  Immunodiagnostic Systems, Boldon, UK SB TR-103 osteoclast marker Commercial assay kit  PureLink RNA mini kit Ambion, Grand Island, NY, USA Catalog number 12183025 RNA isolation Other (PCR reagent) iTaq universal SYBR green super-mix BioRad, Hercules, CA, USA Catalog number 1725120 qRTPCR Sequence based reagent TRAP-F: CGACCATTGTTAGCCACATACG IDT, Coralville, Iowa, USA Sequence ID: 006509945.3 PCR Primer Sequence based reagent TRAP-R: CACATAGCCCACACCGTTCTC IDT, Coralville, Iowa, USA Sequence ID: 006509945.3 PCR Primer Sequence based reagent CTSK-F: ATGTGGGTGTTCAAGTTTCTGC IDT, Coralville, Iowa, USA Sequence ID: XM_006500974.4 PCR Primer Sequence based reagent CTSK-R: CCACAAGATTCTGGGGACTC IDT, Coralville, Iowa, USA Sequence ID: XM_006500974.4 PCR Primer Sequence based reagent MMP9-F: ACTGGGCTTAGATCATTCCAGCGT IDT, Coralville, Iowa, USA Sequence ID: XM_006498861.3 PCR Primer Sequence based reagent MMP9-R: ACACCCACATTTGACGTCCAGAGA IDT, Coralville, Iowa, USA Sequence ID: XM_006498861.3 PCR Primer Sequence based reagent NFATc1-F: CCGGGACGCCCATGCAATCTGTTAGT IDT, Coralville, Iowa, USA Sequence ID: AC123818.4 PCR Primer Sequence based reagent NFATc1-R: GCGGGTGCCCTGAGAAAGCTACTCTC IDT, Coralville, Iowa, USA Sequence ID: AC123818.4 PCR Primer     Animals Nemo-floxed (NM-f/f) mice on a C57BL/6 background were provided by Dr. Manolis Pasparakis (Cologne, Germany). The NEMO-K270A-floxed and NEMO-WT-Tg-floxed mice were generated at the Mouse Genetics Core, Washington University (St. Louis, MO). To generate NEMO-K270A and NEMO-WT-floxed transgenic mice; cDNA encoding NEMO-K270A mutation and NEMO-WT preceded by a loxP-flanked STOP cassette was cloned into the ubiquitously expressed ROSA26 locus (Fig S2A-B). In order to conditionally delete NEMO and express NEMO-K270A or NEMO-WT-Tg in myeloid cells, the NEMO f/f, NEMO-K270A-f/f and NEMO-WT-Tg f/f mice were crossed with LysozymeM-cre mice to generate LysM-cre-NEMO-flox (NM-cKO), LysM-cre-NEMO-K270A-f/f (NM-KA) and LysM-cre-NEMO-WT-f/f (NM-WT-Tg) respectively. NF-ĸB-GFP-luciferase reporter mice were purchased from The Jackson Laboratory (Bar Harbor, ME, USA). ISG15 knock-out mice were provided by Dr. Deborah Lenschow (Washington University in St. Louis, MO, USA). All the animals were housed at the Washington University School of Medicine barrier facility. All experimental protocols were carried out in accordance with the ethical guidelines approved by the Washington University School of Medicine Institutional Animal Care and Use Committee.   MicroCT and X-Ray analysis 6-7 weeks old mice were sacrificed and Intact long bones (femur and tibia) from different animals were isolated. The bones were fixed overnight in 10% neutral buffered formalin. After fixation, they were washed with Phosphate Buffer Saline (PBS) and transferred to 70% ethanol (v/v). After fixation, bones were then scanned using Scanco Medical micro-CT systems (Scanco, Wayne, PA, USA) at the core facility at the Musculoskeletal Research Center at Washington University (St. Louis, MO). Briefly, Images were scanned at a resolution of 20 μm, slice increment 20 μm, voltage 55 kV, current 145 μA and exposure time of 200 ms. After scanning, contours were drawn from the growth plate toward trabecular regions of femur. Approximately 150 slices were analyzed. Later contours were drawn and 3D images were constructed. X-ray analysis of whole body and isolated knee joints were performed using Faxitron Ultra Focus 100 on automatic settings and at 3X and 5X magnification, respectively.   Histology 6-7 weeks old mice were sacrificed and long bones (femur and tibia) from different animals were isolated. The bones were fixed overnight in 10% neutral buffered formalin. After fixation, bones were then decalcified for 2 weeks in decalcification buffer (14% (w/v) EDTA, NH4OH, pH 7.2), dehydrated in graded ethanol (30–70%), cleared through xylene, and embedded in paraffin. Paraffin sections were stained for TRAP to visualize osteoclasts in the bone sections.   Transfection and retroviral infection For exogenous expression studies, various constructs (cDNA) were cloned in retroviral pMX- retroviral vector (Cell biolabs, San Diego, CA). For different studies we generated pMX-GFP, pMX-flag-NEMO-WT, pMX-flag-NEMO-K270A-RFP, pMX-flag-NEMO-D304N, pMX-flag-NEMO-K319A, pMX-flag-NEMO-WT-GFP, pMX-HA-ISG15, pMX-flag-NEMO-WT-ISG15-GFP, pMX-flag-NEMO-K270A-ISG15-GFP. To generate retroviral production pMX-vectors were first transfected into PLAT-E cells (Cell biolabs, San Diego, CA) using xtreme gene 9 (Roche, San Francisco, CA, USA), followed by collection of virus containing media for next 2 days. This virus containing media with Polybrene (0.8mg/ml) was used to transduce primary bone marrow cells.   Cell Culture and Osteoclastogenesis Total bone marrow cells were isolated from the long bones (femur and tibia) and cultured in α-MEM media supplemented with 100 units/mL penicillin/streptomycin and 10% FBS (v/v) with 10 ng/mL M-CSF overnight to separate the adherent cells. One day after isolation, the non-adherent cells were collected and used as enriched bone marrow–derived macrophage (BMMs). BMMs were further cultured with M-CSF (20 ng/mL) and RANKL (50 ng/mL) for 4 days followed by fixation and TRAP staining using TRAP-Leukocyte kit (Sigma, St Louis, MO, USA). To investigate changes in autophagy, BMMs were cultured in M-CSF (20 ng/mL) and RANKL (50 ng/mL) for 2 days and used as pre-osteoclast (preOC) for different experiments.  To investigate the effect of exogenous expression of different NEMO, NEMO mutants and ISG15, the BMMs after one day of isolation, were transduced with retroviral particles (generated using PLAT-E cells) and osteoclast differentiation was initiated after 2 day of viral transduction.   RelA-Luc reporter assay BMMs isolated form NF-ĸB-GFP-luciferase reporter mice were transduced with different pMX-retroviral particles. One day after transduction, the cells were cultured in the presence of M-CSF for two days, followed by RANKL treatment. Post RANKL transfection, cells were lysed and RelA-luciferase activity was measured using luciferase assay system (GoldBio, St. Louis, MO). The luciferase activity was normalized with total protein concentration (BCA assay, Pierce, Invitrogen).   Western blot Analysis BMMs and/or pre-OC (BMMs treated with RANKL for 2 days) were lysed in cell lysis buffer (Cell Signaling Technology, Danvers, MA, USA) post treatments. Protein concentration was determined using BCA (Pierce, Invitrogen) and equal amounts of protein was loaded onto SDS-PAGE. After transfer, and blocking in 5% BSA for 1 h at room temperature, membranes were probed with primary antibodies in 5% BSA in PBS-Tween (1% v/v) for overnight and then washed with PBS-Tween (3x) and probed with secondary antibodies from LI-COR (Odyssey Imager; donkey anti-rabbit and anti-mouse) for 1 h at room temperature. Membranes were then with PBST (3x) and scanned by using LI-COR Odyssey Imager (LI-COR Biosciences, Lincoln, NE, USA). Western blots were also performed (for LC3 and actin) using capillary-based immunoassay using the Wes-Simple Western method with the anti-rabbit detection module (Protein Simple). Protein expression was measured by chemiluminescence. The NEMO and ISG15 antibody were purchased from Santa Cruz, Dallas, TX, USA; phos-p65, p65 and LC3 antibodies were purchased from Cell Signaling Technology, Danvers, MA, USA; Flag and β-actin was purchased from Sigma, St. Louis, MO, USA.   Flow cytometer Analysis Single cell suspensions from bone marrow were prepared by flushing the marrow out of femur and tibia of mice injected with BrdU (100ul of 10 mg/mL solution of BrdU in sterile 1X DPBS) 1 days before sacrifice. Following red blood cell lysis, whole bone marrow cells were stained by Zombie UVTM dye to distinguish live/dead cells. Then bone marrow cells were resuspended in PBS with 2% FBS (FACS buffer), and further stained with biotin-conjugated lineage Ab cocktail (anti-B220, anti-CD3e, anti-Gr1, anti-Ter119). LSK+ (Lin-Sca1+ckit-) cells were stained with Ab cocktail (anti-Sca1 PerCP Cy5.5, anti-c-Kit APC eFluor 780, anti-CD34 FITC, and CD16/32 eFluor450). All FACS antibodies were purchase from either eBioscience, BioLegend (San Diego, CA, USA) or BD Bioscience (San Diego, CA, USA). Following incubation on ice for 45 min, Ab-labeled cells were washed with FACS buffer and subjected to flow cytometric analysis (BD X-20). Data were analyzed with FlowJo software (Tree Star Inc.). To measure autophagy flux, flow cytometry analysis of LC3-GFP levels in NEMO WT and NEMO K270A preOC was performed, in response to autophagy induction by serum starvation. preOC were transduced with PMRX-GFP-LC3-RFP retrovirus generated in PLAT-E packing cells. Cells were serum starved for 6 hours and a flow cytometry analysis was done to detect GFP signal. Data was analyzed using FlowJo V10.1 software   Multiplex ELISA Blood from NM-WT and NM-KA mice were collected from submandibular vein and serum was separated using BD-Microtainer tubes. The serum inflammatory cytokine levels were measured using multiplex mouse cytokine kits (R&D Systems [Minneapolis, MN, USA] and Millipore [San Diego, CA, USA]). Serum cross‐linked telopeptide of type I collagen (CTX‐I) and TRAP levels were measured using the RatLaps (CTX-1) EIA and Mouse TRAP (TRAcP 5b) kits (Immunodiagnostic Systems, Boldon, UK) using manufacturer's protocol.   Quantification of mRNA levels by Real-time PCR BMMs were cultured in presence of M-CSF (20 ng/mL) and RANKL (50 ng/mL) for 3 or 4 days as indicated in the figures. mRNA was isolated using PureLink RNA mini kit (Ambion, Grand Island, NY, USA) and cDNA were prepared using high capacity cDNA reverse transcription kit (Applied Biosystems). Realtime PCR was carried out on BioRad CFX96 real time system using iTaq universal SYBR green super-mix (BioRad, Hercules, CA, USA). mRNA expression were normalized using β-actin as a housekeeping gene. The following primers were used for qPCR analysis. TRAP-F: CGACCATTGTTAGCCACATACG, TRAP-R: CACATAGCCCACACCGTTCTC, CTSK-F: ATGTGGGTGTTCAAGTTTCTGC, CTSK-R: CCACAAGATTCTGGGGACTC, MMP9-F: ACTGGGCTTAGATCATTCCAGCGT, MMP9-R: ACACCCACATTTGACGTCCAGAGA, NFATc1-F: CCGGGACGCCCATGCAATCTGTTAGT, NFATc1-R: GCGGGTGCCCTGAGAAAGCTACTCTC.   Immuno-Electron Microscopy For immunolocalization at the ultrastructural level, preOC from NM-WT and NM-KA mice were fixed in 4% paraformaldehyde/0.05% glutaraldehyde (Polysciences Inc., Warrington, PA) in 100mM PIPES/0.5mM MgCl2, pH 7.2 for 1 hr at 4°C.  Samples were then embedded in 10% gelatin and infiltrated overnight with 2.3M sucrose/20% polyvinyl pyrrolidone in PIPES/MgCl2 at 4°C.  Samples were trimmed, frozen in liquid nitrogen, and sectioned with a Leica Ultra cut UCT7 cryo-ultramicrotome (Leica Microsystems Inc., Bannockburn, IL).  Ultrathin sections of 50 nm were blocked with 5% FBS/5% NGS for 30 min and subsequently incubated with indicated primary antibodies for 1 hr at room temperature (Note that I tried some of the labeling with primary antibody overnight at 4C).  Following washes in block buffer, sections were incubated by the appropriate colloidal gold conjugated secondary antibodies (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA) for 1 hr.  Sections were stained with 0.3% uranyl acetate/2% methyl cellulose and viewed on a JEOL 1200 EX transmission electron microscope (JEOL USA Inc., Peabody, MA) equipped with an AMT 8 megapixel digital camera and AMT Image Capture Engine V602 software (Advanced Microscopy Techniques, Woburn, MA).  All labeling experiments were conducted in parallel with controls omitting the primary antibody.  These controls were consistently negative at the concentration of colloidal gold conjugated secondary antibodies used in these studies. Mass-spectroscopy Protein Identification — MS raw data were converted to peak lists using Proteome Discoverer (version 2.1.0.81, Thermo-Fischer Scientific) with the integration of reporter-ion intensities of TMT 10-plex at a mass tolerance of ±3.15 mDa (Werner et al., 2014).  MS/MS spectra with charges +2, +3 and +4 were analyzed using Mascot search engine(Perkins et al., 1999)  (Matrix Science, London, UK; version 2.6.2).  Mascot was set up to search against a SwissProt database of mouse (version June, 2016, 16,838 entries) and common contaminant proteins (cRAP, version 1.0 Jan. 1st, 2012, 116 entries), assuming the digestion enzyme was trypsin/P with a maximum of 4 missed cleavages allowed.  The searches were performed with a fragment ion mass tolerance of 0.02 Da and a parent ion tolerance of 20 ppm. Carbamidomethylation of cysteine was specified in Mascot as a fixed modification.  Deamidation of asparagine, formation of pyro-glutamic acid from N-terminal glutamine, acetylation of protein N-terminus, oxidation of methionine, and pyro-carbamidomethylation of N-terminal cysteine were specified as variable modifications.  Peptide spectrum matches (PSM) were filtered at 1% false-discovery rate (FDR) by searching against a reversed database and the ascribed peptide identities were accepted. The uniqueness of peptide sequences among the database entries was determined using the principal of parsimony.  Protein identities were inferred using a greedy set cover algorithm from Mascot and the identities containing ³ 2 Occam’s razor peptides were accepted(Koskinen et al., 2011).  Protein Relative Quantification — The processing, quality assurance and analysis of TMT data were performed with proteoQ (version 1.0.0.0, https://github.com/qzhang503/proteoQ), a tool developed with the tidyverse approach (https://CRAN.R-project.org/package=tidyverse) under the free software environment for statistical computing and graphics, R (https://www.R-project.org/) and RStudio (http://www.rstudio.com/).  Briefly, reporter-ion intensities under 10-plex TMT channels were first obtained from Mascot, followed by the removals of PSM entries from shared peptides or with intensity values lower than 1E3.  Intensity of PSMs were converted to logarithmic ratios at base two, in relative to the average intensity of reference samples within a 10-plex TMT.  Under each TMT channel, Dixon’s outlier removals were carried out recursively for peptides with greater than two identifying PSMs.  The median of the ratios of PSM that can be assigned to the same peptide was first taken to represent the ratios of the incumbent peptide. The median of the ratios of peptides were then taken to represent the ratios of the incumbent protein. To align protein ratios under different TMT channels, likelihood functions were first estimated for the log-ratios of proteins using finite mixture modelling, assuming two-component Gaussian mixtures (R package: mixtools:: normalmixEM http://www.jstatsoft.org/v32/i06/).  The ratio distributions were then aligned in that the maximum likelihood of the log-ratios are centered at zero for each sample.  Scaling normalization was performed to standardize the log-ratios of proteins across samples.  To discount the influence of outliers from either log-ratios or reporter-ion intensities, the values between the 5th and 95th percentile of log-ratios and 5th and 95th percentile of intensity were used in the calculations of the standard deviations.  Informatic and Statistical Analysis — Metric multidimensional scaling (MDS) and Principal component analysis (PCA) of protein log2-ratios was performed with the base R function stats::cmdscale and stats:prcomp, respectively. Heat-map visualization of protein log2-ratios was performed with pheatmap (Raivo Kolde (2019). pheatmap: Pretty Heatmaps. R package version 1.0.12. https://CRAN.R-project.org/package=pheatmap). Linear modelings were performed using the contrast fit approach in limma(Ritchie et al., 2015), to assess the statistical significance in protein abundance differences between indicated groups of contrasts. Adjustments of p-values for multiple comparison were performed with Benjamini-Hochberg (BH) correction.   Immunofluorescence Post-treatments preOCs were fixed using 4% para-formaldehyde and 0.1% glutaraldehyde for 20  min at room temperature. Post-fixation the cells were washed using PBS (3x) followed by blocking and permeabilization using 0.5% Goat serum and 0.1% saponin (in PBS). Permeabilized cells were later incubated with Primary antibodies (LC3, NEMO, ISG15 and LAMP1 at 1:200 dilution) and Alexa-Fluor secondary antibodies diluted (1:2000) in antibody incubation buffer (1% BSA in 0.1% Saponin in PBS). Fluorescent images were taken at 40X magnification. The images were analyzed using Image-J software.   Statistical Analysis Statistical analyses were performed by using Student t test and Mann Whitney U test. Multiple treatments were analyzed by using one-way ANOVA. For Serum-cytokines analysis outliers were identified using ROUT method. Values are expressed as mean ±SD. P values are indicated where applicable. All the statistical analyses were done using GraphPad Prism software. Double-blind analysis was performed to analyze the IF and EM images. Number of experiment repeats, biological replicates and P values are indicted in figure legends.
创建时间:
2020-03-27
二维码
社区交流群
二维码
科研交流群
商业服务