TABLE 1 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

TABLE 1. Primers used to amplify loci used for assessment of Shellenius serratus sp. nov. and corresponding annealing temperatures and extension times. Primer NameGeneSequence (5’→3’)AnnealingExtensionReferenceLCO1490 HCO2198COIGGTCAACAAATCATAAAGATATTG TCAGGGTGACCAAAAAAATCA40˚C1 min. 30 sec.Folmer et al. 199418SACDN_F1 18SACDN_R118SAGAGGGAGCCTGAGAAACG GGGCAGGGACGTAATCAAC60˚C1 min. 45 sec.Bahder et al. 2023V/Forward X/Reverse28SGTAGCCAAATGCCTCGTCA CACAATGATAGGAAGAGCC55°C1 min. 30 sec.Cryan et al. 2000