Sequencing-based quantitative mapping of the cellular small RNA landscape
收藏资源简介:
We report the development of an RNA sequencing method – AQRNA-seq – that minimizes biases and enables absolute quantification of all small RNA species in a sample mixture. Validation of AQRNA-seq library preparation and data mining algorithms using a 963-member microRNA reference library, RNA oligonucleotide standards of varying lengths, and northern blots demonstrated a direct, linear correlation between sequencing read count and RNA abundance. The goal of the overall design was to develop a new, quantitative RNA-seq method. To evaluate the extent to which ligation and other steps may introduced biases to our results, we used 1) a set of 5 synthetic RNA oligonucleotide species of varying lengths mixed in different abundances (5 samples x 3 replicates each) and 2) an equimolar mixture of 963 synthetic microRNAs (3 replicates) to test the quantitative accuracy of our method - These 18 samples correspond to the data files shared here. The 5 synthetic RNA oligonucleotide species of varying lengths are: 25-mer: NNCAUUGUUAAGCGAACGGCUGCNN 40-mer: NNNUAUCCUAAUCAUCUUAAUACUACAAUGGACCAUGNNN 60-mer: NNNCGACCCAAGUUGUCUGAUUAAGCAUAUUAAGAGCCGAGGAUCGUAUCGCCACCCNNN 80-mer #1: UCCUGAUAAUUGCAGAGAAGUGACUUCGUGGGUGUCACCAGUAAUAAGGCAUCGCCAGCUAACAAUCGGUGGGAACGUCA 80-mer #2: UGUCUUUCACGGAGACUGCGGGUAGCUCUGACAAGCUCCUAUGGUGAUACCACCACGCUCGUAAUGAGAUGGGAUAGUCG



