IsomiR Utility in ALS Prognostication (ALS)

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease characterized by progressive motor neuron loss. IsomiRs are microRNA (miRNA) isoforms that arise from alternative processing or editing events during miRNA biogenesis. While isomiRs may carry distinct biological and clinical relevance, their potential as cell-free biomarkers in neurodegeneration remains largely unexplored. Here we investigated the prognostic utility of plasma isomiRs in ALS, using next-generation sequencing. We profiled cell-free isomiRs in 154 ALS patients from a British cohort and identified higher levels of one isomiR, let-7g-5p.t, to be associated with longer survival. This finding was independently validated in an international ALS cohort of 200 patients and was in two orthogonal approaches. let-7g-5p.t prognostic utility was comparable to that of neurofilament light chain (NfL) or miR-181. These results establish isomiRs as a novel class of blood-based biomarkers in ALS with potential to refine prognostication in clinical trials for neurodegenerative diseases. Overall design: The molecular experimenters were blinded to the identity of the samples. Total RNA was extracted from 500µl plasma using miRNeasy Micro Kit following the manufacturer's protocol except adding 2.5ml of Qiazol to each plasma sample (Qiagen, #217084). RNA was quantified with a Qubit fluorometer using the RNA Broad Range Assay Kit (Thermo Fisher Scientific, #Q10211). Small RNA next-generation sequencing libraries were prepared using the QIAseq miRNA Library Kit (Qiagen, #331502) from 7.5 ng of total RNA. If RNA concentration was below the limit of detection, 5µl of undiluted RNA were used. Precise linear quantification of miRNAs was achieved by 12-nucleotide long unique molecular identifiers (UMIs). Samples were randomly assigned to the preparation of libraries indexed with QIAseq miRNA NGS 48 Index IL (Qiagen, #331595) and sequenced in batches of 48 or fewer samples. Library concentration was determined with a Qubit fluorometer (dsDNA High Sensitivity Assay Kit, Thermo Fisher Scientific, #Q32854) and library size with TapeStation D1000 (Agilent). Libraries with different indices were multiplexed and sequenced on a NextSeq 500/550 v2 (Illumina, #20024906) or a NovaSeq 6000 flow cell (Illumina, #20028401), with a 75-bp single read or paired-end reads with 6-bp index. FASTQ files were de-multiplexed using the user-friendly transcriptome analysis pipeline. Human miRNAs and isomiRs, as defined by miRBase - V22, were mapped using CLC genomic workbench 22.0 (Qiagen) only to the positive strand. Reads were trimmed in two consecutive fashions; Phred score, Q based error was calculated for every nucleotide, high values reflect poor read quality. A trimming score defined by the subtraction of the error from a threshold of 0.05 was set for each nucleotide. Then, a running sum of the nucleotide errors was calculated per read. The region between the first positive value of the running sum and the highest value of the running sum was kept with non-positive score reads being removed completely. Consecutively, reads' ends were trimmed to keep the maximum length region containing 2 or fewer ambiguous nucleotides. This was followed by the library's 3'-adaptors (TGGAATTCTCGGGTGCCAAGG) trimming, with reads that did not contain any adaptors being excluded from downstream analyses. Reads were filtered based on lengths of 15-55 bps. IsomiRs were considered as 2bps changes (insertion, deletion, shift, and mismatch) up/downstream from miRBase reference sequence with a maximum of 2 mismatches allowed in alignment. The algorithm prioritizes perfect matches to reference miRNAs, followed by sequences of increasing mismatch nucleotides. When a sequence aligns equally well to multiple isomiRs, counts are assigned uniformly across all matching forms.