Deciphering cis-regulatory logic with 100 million synthetic promoters

In order to generate data suitable to decipher cis-regulatory logic, we generated ~100 million synthetic promoters (in yeast) comprised of random DNA and measured their expression by FACS (sorting into 18 bins). One such library (pTpA) was tested in glucose (YPD), galactose (YPGal), and glycerol (YPGly), the other (Abf1TATA) only in glucose. A separately constructed pTpA library of limited complexity was assayed separately, yielding higher quality expression measurements. A final library containing diverse promoter scaffolds was tested in glucose. The sequences flanking the random 80 bp oligo were as follows: the pTpA distal region was (pT) GCTAGCAGGAATGATGCAAAAGGTTCCCGATTCGAACTGCATTTTTTTCACATC and proximal region (pA) was GGTTACGGCTGTTTCTTAATTAAAAAAAGATAGAAAACATTAGGAGTGTAACACAAGACTTTCGGATCCTGAGCAGGCAAGATAAACGA (up to the theoretical TSS). For Abf1TATA, the distal region was GCTAGCTGATTATGGTAACTCTATCGGACTTGAGGGATCACATTTCACGCAGTATAGTTC and proximal was GGTTTATTGTTTATAAAAATTAGTTTAAACTGTTGTATATTTTTTCATCTAACGGAACAATAGTAGGTTACGCTAGTTTGGATCCTGAGCAGGCAAGATAAACGA. In both cases, 80 Ns were inserted in between proximal and distal regions. The scaffold library contained a variety of proximal and distal DNA fragments, and was grown in YPD. The Native80 and designed-sequence libraries were grown in YPD and used a strain of S288C with Ura3 deleted. All others used strain Y8205 (Boone Lab).