Antarctic waters represent a unique marine environment delimited by an oceanographic barrier, the Polar Front Zone, and characterized by constant subzero temperatures and presence of sea ice. A group
This item includes an ITS sequence alignment of Kluyveromyces spp. strains and a phylogenetic tree based on that alignment. The tree was constructed to determine the species-level identity of strain 2
A unique new species, Oreocharis scutifolia Z. Xie, Miao Zhang & H. H. Kong, endemic to the Dry and Hot Valley of Jinsha River Basin, Yunnan, China, is described and illustrated here. It is
Table 2. Primers used for molecular phylogeny. NameSequenceGeneDirectionSourceLepF1ATTCAACCAATCATAAAGATATTGGCOIFHebert et al. 2004LCO1490GGTCAACAAATCATAAAGATATTGGCOIRFolmer et al. 1994LepR1TAAACTTCTGG