Endophytic microbiome of grapevine wood tissue infected with the fungus Lasiodiplodia brasiliensis

The fermented sludge of kitchen waste and grapevine wood (KWW) was produced through a three-month anaerobic solid fermentation process. This process used one-year-old mature compost made from leaves and pruned dry shoots of grapevine, collected during one annual cycle from a vineyard, and mixed with kitchen waste in a 2:1 ratio. The potential suppressive effect of the KWW sludge was tested against L. brasiliensis, a fungus pathogen causing Grapevine Trunk Disease (GTD) on grapevine.Objectives: (1) to determine whether the organic amendment (KWW) influences the diversity and structure of endophytic microbiota, and (2) to evaluate how L. brasiliensis colonization affects the diversity and composition of the endophytic community in grapevine.A factorial experiment was conducted with two fertilization treatments: a chemical inorganic fertilizer nutrient solution and the KWW extract at 10% (control and KWW), and two conditions: infected and non-infected (free), with four replicates each. The grapevine shoots (20cm) were maintained in a liquid extract of the organic amendment and the chemical inorganic fertilizer. The canes were inoculated with 40 microliters of a spore suspension using a drill. After 30 days, a section of about 2 cubic centimeters of wood tissue surrounding the wound was removed and processed for DNA extraction. For amplicon sequencing, the universal primers ITS1f (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (GCTGCGTTCTTCATCGATGC) were used to amplify the region ITS1-1F and the universal primers 515F (GTGYCAGCMGCCGCGGTAA) and 806R (GGACTACNVGGGTWTCTAAT) were used to amplify region V4 of 16S rRNA gene.Each replicate from the treatments control (-), control(+), KWW(infected), and KWW(free) is identified with a label "B" for bacteria and "F" for fungi, followed by its number.The results showed that the KWW extract modified the bacterial endophytic structure and the latent L. brasiliensis infection shaped the fungal communities. The fermented sludge KWW had a suppressive effect on L. brasilienisis infection by about 70%, associated with humic substances and beneficial endophytes interaction.