rCRUX Generated Ford Fish 16S Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.

Primer Name:  Ford Fish 16S
Gene:   16S
Length of Target:    330
get_seeds_local() minimum length:    279
get_seeds_local() maximum length:    477
blast_seeds() minimum length:    231
blast_seeds() maximum length:    429
max_to_blast:  1000
Forward Sequence (5'-3'):   GCAATCACTTGTCTTTTAAATGAAGACC, GTAATCACTTGTCTTTTAAATGAAGACC
Reverse Sequence (5'-3'):    GGATTGCGCTGTTATCCCTA
Reference:    Ford MJ, Hempelmann J, Hanson MB, Ayres KL, Baird RW, et al. (2016) Estimation of a Killer Whale (Orcinus orca) Population’s Diet Using Sequencing Analysis of DNA from Feces. PLOS ONE 11(1): e0144956. https://doi.org/10.1371/journal.pone.0144956

We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.