Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect krill species of the Southern Ocean in environmental DNA samples

This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG, amplicon size ~209 bp including primers). Samples were collected in 2019 on a resupply voyage between Davis station (Antarctica) and Hobart (Tasmania). Further information on the samples, the data and the species detected can be found in the associated publication (Suter et al. (2023) Environmental DNA of Antarctic krill (Euphausia superba): measuring DNA fragmentation adds a temporal aspect to quantitative surveys. Environmental DNA).