Functional characterization of a single nucleotide polymorphism associated with Alzheimer's Disease in a hiPSC-based neuron model.
收藏资源简介:
Neurodegenerative diseases encompass a group of debilitating conditions resulting from progressive nerve cell death. Of these, Alzheimer's disease (AD) occurs most frequently, but is currently incurable and has limited treatment success. Late onset AD, the most common form, is highly heritable but is caused by a combination of non-genetic risk factors and many low-effect genetic variants whose disease-causing mechanisms remain unclear. By mining the FinnGen study database of phenome-wide association studies, we identified a rare variant, rs148726219, enriched in the Finnish population that is associated with AD risk and dementia, and appears to have arisen on a common haplotype with older AD-associated variants such as rs429358. The rs148726219 variant lies in an overlapping intron of the (FosB proto-oncogene) FOSB and (ERCC excision repair 1) ERCC1 genes. To understand the impact of this SNP on disease phenotypes, we performed CRISPR/Cas9 editing in a human induced pluripotent stem cell (hiPSC) line to generate isogenic clones harboring heterozygous and homozygous alleles of rs148726219. hiPSC clones differentiated into induced excitatory neurons (iNs) did not exhibit detectable molecular or morphological variation in differentiation potential compared to isogenic controls. However, global transcriptome analysis showed differential regulation of nearby genes and upregulation of several biological pathways related to neuronal function, particularly synaptogenesis and calcium signaling, specifically in mature iNs harboring rs148726219 homozygous and heterozygous alleles. Functional differences in iN circuit maturation as measured by calcium imaging were observed across genotypes. Edited mature iNs also displayed downregulation of unfolded protein response and cell death pathways. This study implicates a phenotypic impact of rs148726219 in the context of mature neurons, consistent with its identification in late onset AD, and underscores a hiPSC-based experimental model to functionalize GWAS-identified variants. Overall design: The BIONi010-C-13 line (donor biosample SAMEA103988285) with doxycycline (DOX)-inducible neurogenin 2 (NGN2) transgene was obtained and is available from the European Bank for Induced pluripotent Stem Cells (EBiSC, www.ebisc.org). CRISPR/Cas9-mediated SNP editing of BIONi010-C-13 was completed by the Genomic Engineering & iPSC Center (GEIC) at Washington University School of Medicine. To generate clones Heterozygous for rs148726219, the parental BIONi010-C-13 line was transfected with HiFi Cas9 v3 (IDT), gRNA with sequence GAGCTGTGGGTGGCTAGGGC, and ~60 bp single-stranded DNA oligos as homology arms flanking the PAM site (left HA: cccgggctctttctacccttaacactctggaaagcctgtgaaatgaaattattccacctcT; right HA: ctagccacccacagctctcctggtgctggtggcatcccccaaaacccactcccttcctac). An episomal vector expressing GFP was used for selection of transfected cells by FACS-based single-cell sorting. Clones were expanded and genotypes confirmed by next generation sequencing (NGS). The wild-type clone was generated in the same CRISPR experiment but was untargeted. To generate homozygous clones, heterozygous clones were re-targeted a second time. Directed differentiation of hiPSCs to excitatory iNs was performed as previously described, with modifications. RNA was isolated from hiPSC-derived induced neurons (iNs) at days 0, 2, 6, 13, and 23 using the AllPrep DNA/RNA mini kit (Qiagen). Samples were extracted manually according to the manufacturer's instructions or on a QIAcube using the AllPrep DNA/RNA mini kit protocol (Qiagen). For each timepoint, RNA from 4 technical replicates (4 independent wells of cells cultured simultaneously) were used per line. RNA library preparation from total RNA was conducted following the manufacturer's protocol for the Kapa mRNA HyperPrep Kit (Roche). Briefly, 250 ng of total RNA was enriched for mRNA using magnetic oligo-dT beads. The remaining RNA was then fragmented by magnesium under elevated temperature. After fragmentation, RNA was depleted of rRNA and globin mRNA using the QIAseq FastSelect RNA Removal Kit (Qiagen). The depleted RNA then underwent first strand synthesis using reverse transcriptase and random primers. Combined second strand synthesis and A-tailing incorporated dUTP into the second cDNA strand for stranded RNA sequencing and added dAMP to the 3' ends for adapter ligation. The cDNA fragments were then ligated to sequencing adaptors (IDT xGEN Dual Index UMI adapters) and was enriched using 16 cycles of PCR. Final libraries were assessed using the Agilent Tapestation and Qubit (ThermoFisher) assay methods then sequenced on an Illumina HiSeq 4000 sequencer using 2 x 75bp read length. Raw fastq reads were subjected to quality control using FastQC (v0.11.7) and quality profiling, filtering for low quality and short reads, adapter trimming and mismatch correction using fastp (v0.20.1) [18]. RNA reads were aligned to the hg38 build of the reference human genome, with transcript annotations from GENCODE, using the STAR aligner. Gene expression was quantified using RSEM (RNA-Sequencing by Expectation Maximization) [19]. The expected count matrix from RSEM was filtered for low expression using a counts-per-million threshold of 1 in at least 40 samples (number of samples in the smallest group of comparison) and further filtered for genes annotated as pseudogenes or pseudo-autosomal regions.



