Sequence of synthetic reporter constructs.

Sequences of synthetic constructs multimerized four times and fused to GFP within reporter constructs are listed according to the tissue that expressed each synthetic reporter (Fig. 9). The CME is enlarged within each sequence. Sites important for midline expression within the wrapper enhancer [67] are underlined in synths 1–6 and include putative binding sites for Sox (ATTGT), pointed (CTCTCCG) and unknown (AAAA) transcription factors. Binding sites for engrailed (TAATTA), Vvl (TTGCAT) and Suppressor of Hairless (GTGGGAACCGAGCTGAAAGTAAGTTTCTCAC) were added to the Toll CME sequence and shown in bold in synths 7–9.