Characterization and biodiversity of native Azotobacter in semi-arid agroecosystems of Eastern Kenya
收藏资源简介:
Declining food production in the African agroecosystems is attributable to changes in weather patterns, soil infertility, and limited farming inputs. The exploitation of plant growth-promoting soil microbes could remedy these problems. Azotobacter, a free-living, nitrogen-fixing bacterium, confers stress tolerance, avails phytohormones, and aids in soil bioremediation. The study aimed to isolate, characterize and determine the biodiversity of native Azotobacter isolates from soils in semi-arid Eastern Kenya. The isolation was conducted on nitrogen-free Ashby’s agar and the morphological, biochemical and molecular attributes were evaluated. The isolates were sequenced using DNA amplicons of 27F and 1492R primers of the 16SrRNA gene loci. The Basic Local alignment search Tool (BLASTn) analysis of their sequences, revealed the presence of three main Azotobacter species viz., Azotobacter vinelandii, Azotobacter salinestris, and Azotobacter tropicalis. Azotobacter vinelandii was the most dominant species. Kitui County had the highest number of recovered Azotobacter isolates (45.4%) with the lowest diversity index (0.8761). Tharaka Nithi County showed the lowest occurrence (26.36%) with a diversity index of (1.057). The diversity was influenced by the soil pH, texture, and total organic content. This study revealed the presence of native strains of Azotobacter species in Kenyan soils with the potential for utilization as a bioinoculant. Methods Soil sampling and physical chemical analysis Soil samples were collected from smallholder farms in Tharaka Nithi, Embu and Kitui counties of Eastern Kenya. The selected study areas received minimal rainfall and are categorized as semi arid. The farms in Tharaka Nithi County were situated in the Tunyai region (0°10’33” S, 37°50’12). In Embu County, soil was collected from farms in Karurumo area (0°29’12”, 37°41’50” E) where agriculture is practiced by 80% of the population. The area is predominantly hot and dry. The sampling site in Kitui County was located in Matinyani area (1°18’30.6” S37°59’30.2” E. These areas are in the lower midland agroecological region experiencing moisture stress with less than 400mm rainfall per annum coupled with high temperatures that result in low crop production(1) Soil sampling was conducted during the dry, post harvest season in August of 2019. The soil samples were obtained from 30 farms within each of the three regions in the Counties; with 20 sampling points in each of the farms. Each sample was thoroughly mixed to create a composite soil sample then collected into sterile khaki bags and labeled. They were then air dried and sieved using 2mm aperture sieve and stored in two portions, at room temperature for soil physicochemical analysis and another at 4°C for Azotobacter isolation. A physicochemical analysis of all the soil samples was conducted by determining the soil pH and soil texture using a glass electrode pH meter and the hydrometer method respectively. Subsequently, the soil samples were grouped as either sandy loam, loamy sandy or sandy clay loam. The total organic matter, total soil nitrogen and the available phosphorus content was determined by the Walkley and Black oxidation method, the macro-Kjeldahl method and Olsen extraction method respectively(2) Isolation, biochemical and morphological analysis of isolates Isolation of Azotobacter from the soil samples was conducted using Ashby’s nitrogen free selective media. One gram of soil sample was placed in a sterile test tube and suspended in 9ml of distilled sterile water then thoroughly agitated. Serial dilutions were prepared up to 10-3 and aliquot of 10µl of each dilution spread on a plate containing Ashby’s Nitrogen-free selective medium (20 g mannitol, 0.2 g NaCl, 0.2 g K2HPO4,0.100 g MgSO4, 0.010 g K2SO4, 5.000 g CaCO3,15g agar )(3).It was then incubated at 28 °C for 5 days. The Azotobacter isolates were characterized in accordance with Bergeys manual of determinative bacteriology and their culture morphology noted as follows; colony color, texture appearance, colony size, shape and margins, elevation on the agar and colony form(4). The production of pigment was evaluated by sub culturing the isolates on modified Ashby’s–benzoate(0.5% w/v) medium and the subsequent pigment production was recorded after incubation at 28 °C for 5 days according to Banerjee et al.(5) procedures. The production of acid in the media was evaluated by growing the isolates in Ashby’s media containing bromothymol blue as an indicator. Molecular characterization Two isolates per morphological group were selected randomly for DNA extraction; they were named P1 to P25.Bacterial cells isolated from the pure five day old plate culture were added to sterile normal saline and vortexed. They were then centrifuged to produce pellet whose DNA was extracted by use of the Zymo Quick -gDNATMMini Prep DNA extraction kit using the manufacturer protocol. Gel electrophoresis was conducted using 1.0% agarose gel and visualized on UV trans-illuminator and then stored for use at -20°C . PCR analysis was conducted by preparing a mixture with 1µl of isolated DNA from each of the 25 purified cultures, 1µl dNTPs, 0.5µl of both forward and reverse primers, 0.125 µl of taq polymerase, 2.5µl of dream taq reaction buffer and 19.375 µl PCR water to top up to a total of 25µl. The universal primers used 27F (5’AGAGTTTGATCCTGGCTCAG 3’) and 1492R (5’TACGGCTACCTTGTTACGACTT 3’) are complimentary to the conserved regions of the bacterial 16SrRNA gene. The PCR reaction was carried out in a Techgene thermocycler (FTGENE5D model) having thermal cycling conditions set as follows; the initial denaturation step was at 95 °C for 3 minutes, 35 cycles were ran (with the denaturation at 94°C for 45 seconds, annealing at 51.8 °C for 45 seconds, elongation at 72 °C for 2 minutes) and final extension step at 72°C for 5 minutes. The samples were finally stored at 4 °C. Gel electrophoresis of 3µl of the PCR product mixed with 2µl of loading dye containing SYBR (Thermo Fisher) green stain was loaded on 1.4% (w/v) agarose gel and electrophoresis done at 80v for 30 minutes. Subsequent visualization was done on a UV trans-illuminator; a 1 Kb DNA ladder was used as reference to estimate the bands molecular size. The PCR products were sent to Macrogen-Netherlands for the purification and Sanger sequencing. The sequencing primers used were 27F (5’AGAGTTTGATCCTGGCTCAG 3’) and 1492R (5’TACGGCTACCTTGTTACGACTT 3’). DATA ANALYSIS After base-calling and creation of a consensus sequence the DNA sequences, were compared to available sequences in the Genbank using Basic Local Alignment Test (BLAST) software on the NCBI database. This was to identify the various strains isolated by comparing with the bacterial lineage standard sequences. The sequences with the highest hits on the 16SrRNA gene were extracted and aligned on the Clustal X program (6). Further, evolutionary analyses were conducted in MEGA X software; the Phylogenetic tree’s evolutionary distance depiction was computed using Jukes – Cantor method and to show the number of base substitutions per site. The analysis involved 33 nucleotide sequences. Codon positions included were 1st+2nd+3rd+Noncoding. All ambiguous positions were removed for each sequence pair. There were a total of 1635 positions in the final dataset.(7). The influence of soil quality on the occurrence and biodiversity of recovered Azotobacter isolates was determined by examining the correlation through a redundancy analysis (RDA).This was achieved by comparing the recovered sequences against the soil physical chemical properties.



