Evolution of sex-specific heat stress tolerance and larval Hsp70 expression in populations of Drosophila melanogaster adapted to larval crowding
收藏NIAID Data Ecosystem2026-03-12 收录
下载链接:
http://datadryad.org/dataset/doi%253A10.5061%252Fdryad.9zw3r22fg
下载链接
链接失效反馈官方服务:
资源简介:
The ability to tolerate temperature stress is an important component of adult fitness. In holometabolous insects like Drosophila melanogaster, adult stress resistance can be affected by growth conditions experienced during the larval stages. While evolution under crowded larval conditions is known to lead to the correlated evolution of many adult traits, its consequences on adult heat stress tolerance have not been investigated. Therefore, in the present study, we assessed the adult heat stress tolerance in populations of D. melanogaster adapted to a stressful larval crowding environment. We used replicate populations of D. melanogaster, selected for adaptation to larval crowding stress (MCUs), for more than 230 generations, and their respective controls (MBs). Larvae from selected and control populations were grown under crowded and uncrowded conditions and their adult heat shock resistance at two different temperatures was measured. Further, we compared Hsp70 expression in crowded and uncrowded larvae of both populations and also measured the Hsp70 expression after a mild-heat treatment in adults of selected and control populations. Our results showed that adaptation to larval crowding leads to the evolution of Hsp70 gene expression in larval stages and improves adult heat-stress tolerance ability in males, but not in females.
Methods
This file ("Raw_data.xlsx") was generated in 2019 by Rohit Kapila.
GENERAL INFORMATION
1. Title of Dataset: "Evolution of sex-specific heat stress tolerance and larval Hsp70 expression in populations of Drosophila melanogaster adapted to larval crowding"
2. Author Information
A. Principal Investigator Contact Information Name: Prof. N. G. Prasad Institution: Indian Institute of Science Education and Research, Mohali Address: IISER Mohali, Sector 81, Knowledge City, SAS Nagar, Punjab – 140306, India. Email: prasad@iisermohali.ac.in
B. Associate or Co-investigator Contact Information Name: Rohit Kapila Institution: Indian Institute of Science Education and Research, Mohali Address: IISER Mohali, Sector 81, Knowledge City, SAS Nagar, Punjab - 140306, India. Email: rohit.kapila.24@gmail.com, mp14006@iisermohali.ac.in
3. Duration of data collection: 2018-2019
4. Geographic location of data collection: Mohali, Punjab, India
5. Information about funding sources that supported the collection of the data: IISER Mohali, Govt. of India.
DATA & FILE OVERVIEW
1. File List: "Raw_data.xlsx" Note: This file contains four separate data sheets (please see below for methodological details) in the following four tabs:
Tab 1. " Survivorship at 37 Degrees" (Data for assay done at 37 °C)
Tab 2. " Survivorship at 37 Degrees" (Data for assay done at 38 °C)
Tab 3. "Larval Gene expression" (Data collected for estimating hsp70 expression in larvae)
Tab 4. "Adult unshocked gene expression " (Data collected for estimating hsp70 expression in unshocked adults)
Tab 5: “Adult shocked gene expression” (Data collected for estimating hsp70 expression in shocked adults)
METHODOLOGICAL INFORMATION
We used eight laboratory populations of D. melanogaster; four of which are selected for adaptation to larval crowding (MCU 1-4) and the other four are controls (MB 1-4). These populations- MB (Melanogaster Baseline controls) and MCU (Melanogaster Crowded as larvae, Uncrowded as adults) were maintained in our laboratory for 230 generations before beginning the current set of experiments at a 25°C and 90% RH in a 24-hour light regime.
Each MCU population was derived from baseline control populations MB (i.e. MCU-1 was derived from MB-1 and so on). Each replicate of MCU was since then maintained as a separate population. Hence, the MCUs that are connected to MBs by the same replicate numbers are their direct descendants; therefore, they were treated as statistical blocks representing ancestry in analyses.
MB populations were derived from four long-term laboratory populations of D. melanogaster called JB populations. In the year 2006, all the four JB populations were mixed together to form a single large population called MB. After 10 generations, the single MB population was split into 4 replicate populations called MB 1-4. The four populations of MB were then maintained as independent populations for 15 generations before MCU was derived from them.
The detailed maintenance regime of control populations is as follows:
MB (Melanogaster Baseline) populations (a set of 4 independently maintained populations) are maintained on a 21-day discrete generation cycle on standard cornmeal-charcoal food. Eggs laid by ~12-day-old females are dispensed into glass vials (25 mm diameter x 90 mm height) containing 6–8 mL of cornmeal-charcoal food at a density of 60–80 eggs per vial. Forty such vials are set up for each of the four replicates. The vials are then incubated at 25 °C temperature, 90% RH, and constant light. 12 days post-egg collection, when almost all the adults have eclosed, flies are transferred into a Plexiglas cage (24x19x14 cm) containing a Petri plate of cornmeal-charcoal food and wet absorbent cotton for maintaining high RH levels. Thus, the adult number is approximately 2500 per population per generation. Fresh food plates are provided every alternate day. On day 18 post-egg collection, the flies are provided with a fresh food plate supplemented with ad libitum live yeast paste. Two days later, the flies are provided with a fresh food plate and are allowed to oviposit for 18 h. These eggs are then used to start the next generation.
The maintenance regime of MCUs is the same as MBs except:
1. Every generation, in MCUs, 800 eggs are collected in 1.5 ml of charcoal-cornmeal food as compared to 60 eggs in MBs in 6ml of food per vial. Because of crowding food runs out in MCUs vials in 3-4 days. Hence, there is larval competition because of crowding in MCUs.
2. Every generation 24 vials of 800 eggs are collected per population in MCUs (i.e 19,200 eggs per population) as compared to 40 vials of 60 eggs in MBs (2,400 eggs per population). In the larval stages, due to larval crowding conditions, there is high mortality in MCU populations and out of 19,200 eggs that are collected every generation, approximately 2400 individuals survive till the adult stages. Therefore, in the adult stages in both MCU and MB populations the adult population size is similar.
3. Because of crowding the eclosion pattern of adults changes and spreads over a span of 10 days, therefore to avoid adult crowding, from day 8 onwards (first fly eclosen day), daily eclosing adults of MCUs are transferred into a cage until day 18. Whereas for MBs, since there is no crowding in vials, all the adults eclose by day 12 post egg collection, and they are transferred to cages on day 12 as described above.
Standardization and generation of experimental flies:
All the populations were standardized for one generation, where they were subjected to similar relaxed conditions, before using them for the experiments. This method is a standard practice to remove non-genetic parental effects. Egg collection for standardized flies was done at a density of 300 flies per bottle, and 4 such bottles per population were collected. Adults emerging from these bottles were transferred to a Plexiglas cage (24x19x14 cm). 36 hours before experimental egg collection, a food plate with ad libitum yeast paste was provided followed by a 6-hour egg-laying window for experimental egg collection.
For all the experiments discussed, each replicate of both selected and control populations had two treatments:
1. The high-density treatment had 600 eggs per vial containing 2 ml food.
2. The low-density treatment had 60 eggs per vial containing 6 ml food.
In our assays, we used 600 eggs per vial as the high-density treatment for both MCU and MB populations. During usual maintenance, MCU populations are held at a density of 800 eggs per vial. Using this density was necessary because the larvae of MB population do not survive to adulthood if grown at 800 eggs per vial density. Therefore, in the high-density assay conditions, the MCU’s were under slightly lower density compared to their normal maintenance.
Larval crowding, as well as adaptation to crowding, affects development time in D. melanogaster population. Therefore, egg collection for different populations and treatments was done on different days, ensuring all the adults were of the same age on the day of the experiment.
Adult heat shock treatment:
From a pilot assay, we discovered that heat shock for an hour at 39 °C kills all the flies, whereas there was very little mortality below 36 °C. Therefore, flies were given a heat shock treatment for an hour at 37 °C and 38 °C. For high larval density treatments, newly eclosed flies were transferred daily to a Plexiglas cage (12 x 11 x 11 cm) containing a Petri plate of cornmeal-charcoal food and wet absorbent cotton for maintaining high humidity levels. For low larval density treatments, flies were transferred to cages on the 12th-day post egg collection. On the day of experiments (when adults from all the treatments were roughly 5 days old) flies were transferred into empty glass vials (25 mm diameter ? 90 mm height), covered with mildly moist cotton. 10 such vials, each with 5 flies of the same sex were set up for each treatment. Therefore, we assayed 50 males and 50 females per density treatment per selection regime for each block (i.e 400 flies per block).
Assays for each replicate population were performed separately following the same protocol. The water bath was big enough to hold 100 vials at a given time. In each of our assays, we had a total of 80 vials ensuring each vial was subjected to the exact same temperature. Therefore, all the flies received the same heat-stress treatment. Soon after the flies were aspirated into empty vials, they were placed into a pre-heated, temperature-controlled, hot water bath for an hour. Vials from all the treatments were randomly shuffled and kept together in the water bath at the same time. In separate assays, flies were subjected to heat stress at 37 °C and 38 °C for an hour. The temperature of the water bath was maintained and monitored throughout the experiment. After one hour of heat treatment, flies were transferred back into food vials, which were then kept at 25° C temperature-controlled incubator for 24 hours. Mortality was observed 24-hour post-heat shock for each vial and the proportion of surviving individuals was calculated for each vial.
Larval and adult Hsp70 Gene expression:
For larval Hsp70 gene expression, egg collection was done from standardized flies. Third instar larvae, which were in their wandering stage were collected and stored at -80 °C till further use. Similarly, for adults, egg collection for the experiment was done from standardized flies. On the day of the experiment, flies from all four adult treatments were divided into two groups; shocked and un-shocked. Five flies of the shocked group were transferred into sex-separated empty glass vials. These vials were then kept in a water bath, which was maintained at 35 °C for an hour. This temperature does not normally induce any mortality within a one-hour duration in D. melanogaster, but gives them a shock and induces Hsp70 expression (25). Un-shocked flies were kept in empty glass vials at 25 °C temperature for one hour. After an hour of heat shock treatment, flies were again shifted to 25 °C for an hour. After an hour, flies from both shocked and un-shocked treatments were stored at -80 °C until further use.
RNA extraction and cDNA preparation:
Flies were homogenized in Trizol (Sigma-Aldrich) using a motorized pestle. The standard RNA extraction protocol was followed to extract RNA (see supplement 1). Extracted RNA was suspended in 30 µl of DEPC treated water. Following this, to check the RNA quality and quantity, Absorbance260/280 (A260/280) was calculated using a NanoDrop spectrophotometer (Thermo Scientific) and samples with A260/280> 1.0 were further used. From the isolated RNA, cDNA was synthesized using a Verso-cDNA kit (Thermo-Fisher, USA) according to the manufacturer’s protocol. The obtained cDNA was further used in semi-quantitative real-time PCR (semi-qRT-PCR) for measuring the gene expression.
Semi-quantitative real-time PCR (semi-qRT-PCR):
Expression of the Hsp70 gene was measured from the cDNA synthesized from the extracted RNA. Expression of housekeeping gene actin was used as an internal control. The PCRs were performed using Maxima SYBR Green qPCR master mix (Thermo-Fisher, USA) and the Eppendorf Realplex master cycler. Primer sequences were designed using the gene sequence available at the NCBI server (available online at https://www.ncbi.nlm.nih.gov/pubmed) and were synthesized by Integrated DNA Technologies, USA. The cycle threshold (CT) was obtained and the expression of each gene was normalized using the expression of internal control. The following calculations were done: delta CT (Normalized gene expression) = CT (Gene of Interest) - CT (Housekeeping gene) For adult Hsp70 gene expression, delta CT values under shocked and non-shocked conditions were obtained for high and low larval density treatment in both MCU and MB. Further, for all the samples, delta CT values of the samples from the shocked treatment were normalized with delta CT values of their respective un-shocked samples. The value thus obtained was denoted as delta delta CT.
delta delta CT=delta CT (shocked sample) - delta CT (un-shocked samples).
The delta delta CT of MCU and MB were compared to each other from their respective densities.
RNA extraction protocol:
In order to extract the RNA: * Two-step ethanol washing of all the samples was done. * Washed samples were then treated with 150 µl TRI reagent to homogenize the flies. * To the homogenized mixture, 30 µl of chloroform was added. The whole mixture was then shaken vigorously and was allowed to stand undisturbed for 2-5 minutes. * The mixture was then centrifuged at 12,000 g for 15 minutes at 4 °C. * The supernatant obtained after the centrifugation was then transferred to a sterile micro-centrifuge tube. * 75 µl of isopropanol was then added to the supernatant obtained in the last step and the solution was mixed slowly. * The solution was then allowed to stand undisturbed for 10 minutes and was subjected to centrifugation for 10 minutes at 12,000 g at 4 °C. * Isopropanol was discarded and 1 ml of 75 % DEPC treated ethanol was added. * The solution was further vortexed and centrifuged at 7,500 g for 5 min at 4 °C. * The supernatant was then discarded. Excess ethanol was allowed to air dry for 5-10 minutes. * Finally, 30 µl of DEPC treated water was added to the RNA pellet. To re-suspend the RNA for further use.
Primer sequences:
Hsp 70
Forward TCGATGGTACTGACCAAGATGAAGG
Reverse GAGTCGTTGAAGTAGGCTGGAACTG
Actin
Forward: ATCGAGCACGGCATCAC
Reverse: CACGCGCAGCTCGTTGTA
创建时间:
2021-06-30



