seqAll_mixEUK

Demultiplexing file from MiSEQ sequencing (2 x 250 bp) of a Mock community (16 species) amplifiying with the following primers: 960F: GGCTTAATTTGACTCAACRCG 1419R: GGGCATCACAGACCTGTTAT For obtaining this file, the paired-end reads were merged together using UPARSE tools (option -fastq_mergepairs with a minimal overlap equal to 150 and no mismatch allowed) (Edgar, 2013). and the merged sequences were then submitted to the following cleaning procedures: (i) no undefined bases (Ns), (ii) a minimum sequence length of 200 bp, and (iii) no sequencing error in the forward and reverse primers. Composition of the mock community: A50 Eukaryota;Rhizaria;Cercozoa; A31 Eukaryota;Alveolata;Perkinsea; A54 Eukaryota;Cryptophyceae A34 Eukaryota;Stramenopiles;Chrysophyceae; A44 Eukaryota;Fungi; PG5-14 Eukaryota;Archaeplastida;Chloroplastida;Chlorophyta;Chlorophyceae PG5-26 Eukaryota;Alveolata;Ciliophora; PG5-28 Eukaryota;Fungi;Cryptomycota; BI109 Eukaryota;Fungi;Cryptomycota; (LKM11 clade) B24 Eukaryota;Stramenopiles;Bicosoecida; B64 Eukaryota;Fungi;Chytridiomycota; B79 Eukaryota;Fungi;Dikarya; B26 Eukaryota;Alveolata;Perkinsozoa BA97 Eukaryota;Cryptophyta; B36 Eukaryota;Stramenopiles;Ochrophyta;Chrysophyceae; BA231 Eukaryota;Alveolata;Ciliophora;Alveolate_1;