ITS fungal diversity bronciectasis infections in ORBIT3 samples

DNA was extracted from sputum samples of bronchiectasis patients, most of which were infected with Pseudomonas aeruginosa under ORBIT3 trial of inhaled ciprofloxacin. To assay fungal diversity, the ITS region was amplifified and sequenced on an Illumina platform to estimate community composition. The primers used are given below: ITS ITS1 F ACACTCTTTCCCTACACGACGCTCTTCCGATCNNNNN - CTTGGTCATTTAGAGGAAGTAA ITS2 R GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT - GCTGCGTTCTTCATCGATGG