Single-cell RNAseq of from murine pancreas tumor (KPC) and chronic pancreatitis (KC)
收藏资源简介:
Pancreatic ductal adenocarcinoma (PDA) is characterized by a desmoplastic extracellular matrix (ECM) that is produced and remodeled by myofibroblastic cancer-associated fibroblasts (myCAFs), thus promoting tumor progression and resistance to therapy. Thus, identification of the regulatory pathways that drive desmoplasia is a pressing clinical need. Transcriptional profiling of tumor resident fibroblasts across PDA progression identified a CAF subset, termed WNT-sensing myCAFs, in both mouse and human PDA. These surround WNT7A/B+ cancer cells and express genes associated with ECM deposition and remodeling. Pharmacological inhibition of ligand-dependent WNT signaling or genetic ablation of Wnt7b in PDA cells depleted the number of WNT-sensing CAFs subpopulation and reduced collagen deposition in vivo, while ectopic Wnt7b expression enhanced desmoplasia. WNT7B overexpression also led to increased metastasis, resulting in a metastatic niche presenting similar WNT-sensing myCAF architecture. Our findings establish WNT7 as a critical regulator of myCAF function and offer a targetable axis to reduce tumor desmoplasia. Overall design: Pancreatic tumors from KPC (Kras+/LSL-G12D; Trp53+/LSL-R172H; Pdx1-Cre), or chronic pancreatitis tissue from KC (Kras+/LSL-G12D; Pdx1-Cre) mice were minced and enzymatically digested in DMEM supplemented with Collagenase D, Dispase, DNase I, and soybean trypsin inhibitor at 37°C. KPC tumor suspensions were then stained for CD45,CD31, EPCAM, and FACS sorted. Fibroblasts were enriched by sorting viable (DAPI-) cells from the population negative for all three markers (triple-negative, "TN"). Alternatively, all viable cells were enriched from the DAPI- fraction ("DN"). KC pancreata were harvested for single-cell RNAseq without sorting. For Wnt7b targeting, Cas9-expressing mT6LOH organoid lines were first established by spinfection with LentiV-Cas9-puro vector (Addgene #108100). The single-guide RNA (sgRNA) cassette (sgRNA1-scaffold-bovineU6-sgRNA2) was synthesized as a gene block (IDT) and cloned into LRG2.1-Blast. sgRNAs targeting Wnt7b were sgRNA1= CTCGCGGAACTTAGGTAGCG, sgRNA2= GTGCAACCGCACCTCGCCGG. For control, sgRNA1=GAAGATGGGCGGGAGTCTTC, targeting the Rosa26 locus and sgRNA2= AGATCATCATATAAGCTTTA, targeting a safe harbor region on chromosome 10 (28474669). KPC-derived mT6LOH organoids were tranduced in culture and single clones selected and verified for loss-of-function mutations by PCR. Orthotopic tumors were grown by injecting 500 cells in the pancreatic parenchyma of C57BL/6J mice, and harvest for scRNA-seq as above.



