Diversity of fungi and bacteria in natural soils

We collected three different natural soils to study the impacts of natural soil microbial communities on aboveground interactions between oak (Quercus robur), herbivores (Phalera bucephala, Tuberculatus annulatus) and a pathogen (Erisyphe spp.). To include a broad range of variation in natural soil microbiomes in our experiment, we collected natural soils of different types from three separate geographic locations (site A, B and C, which were 1 to 1.5 km apart) in nature reserve Norra Djurgarden, Stockholm. We ensured that oaks were naturally occurring at each site. Site A was a deciduous forest where soil was mostly sandy (59.364584, 18.049175), site B was a mixed deciduous forest where the soil was a mix of clay and sand (59.368763, 18.070849), and site C was a grass meadow, where the soil contained mostly clay (59.368815, 18.049952). We then mixed equal amounts of soil from the three different sites (1:1:1), whereby the soil from two out of three sites was sterilized by autoclaving (soils were not sieved). In this way, we created 3 soil mixes, each with 1 part unsterilized and 2 parts sterilized soil (referred to as soil mixes A, B, and C, respectively, according to the origin of the non-sterilized soil). Soil mixes thus differed in their biotic, but not abiotic, characteristics, which ensured that any soil effects observed in this experiment were caused by differences in the biotic compositions rather than in soil texture or fertility. Since we aimed to study the aboveground consequences of differences in soil microbiomes, and not the effect of the presence of a soil microbiome per se, we did not include a treatment consisting of a mix with only sterile soils (Bezemer et al., 2006, Kardol et al., 2006, Tack et al., 2015). We filled 7 x 7 x 18 cm, 700 mL pots with 300 mL sterilized and nutrient-poor potting soil (Sa och pluggjord, SW Horto, Hammenhog, Sweden), 125 ml of natural soil mix (soil mix A, B or C), again 250 ml sterilized potting soil, and topped off with 25 ml sterilized sand (method adopted from Rasmussen et al., 2020 and Tack et al., 2015, modified to our study system). To characterize the microbial composition of three natural soils, we used amplicon sequencing of the ITS and 16S regions to identify fungal and bacterial taxa, respectively. Three weeks after pots were filled with soil A, B or C, we took soil cores (1 cm in diameter, to a depth of 10 cm) of 15 randomly selected pots for each soil microbiome. Each soil sample (i.e. an individual soil core) was thoroughly mixed, after which we stored 2 ml of each sample in a sterile Eppendorf tube at -20C. DNA extractions were conducted using the DNeasy PowerSoil Kit (Qiagen), following the manufacturer protocol. To identify the fungal taxa, we used tagged primers targeting the ITS2 region, with forward primer ITS3 KYO2 (GATGAAGAACGYAGYRAA) and reverse primer ITS4 reverse (TCCTCCGCTTATTGATATGC). To identify bacterial taxa, we used primers targeting the 16S region, with forward primer 515bF (GTGYCAGCMGCCGCGGTAA) and reverse primer 806 reverse (GGACTACNVGGGTWTCTAAT). Amplification of the ITS2 and 16S regions was verified with a spot-check on a 2% agarose gel. Samples were barcoded to facilitate binding of the DNA to the flowcell (i5 and i7), and barcode incorporation was verified for each sample on a 2% agarose gel. Quantification of each of the amplicons was conducted with the Quant-iT PicoGreen dsDNA Assay Kit (Life Technologies). Libraries were generated by pooling the same quantity (ng) of each amplicon. Libraries were cleaned with sparQ PureMag Beads (Quantabio). The libraries were quantified using Kapa Illumina GA with Revised Primers-SYBR Fast Universal kit (Kapa biosystems). Average fragment size was determined using a LabChip GX (PerkinElmer) instrument. Before sequencing, 12% of phix control library was added to the amplicon pool, loaded at a final concentration of 8pM. The amplicon pool was sequenced with the Illumina MiSeq system, using the MiSeq Reagent kit v2 500 cycles (Illumina) and LNA modified custom primers (Exiqon) (primer read 1, LNA-CS1: ACACTGACGACATGGTTCTACA; primer read 2, LNA-CS2: TACGTAGCAGAGACTTGGTCT; primer index read, LNA-CS2rc: AGACCAAGTCTCTGCTACCGTA). All molecular work was conducted by Genome Quebec (Canada).