dispersal restriction and facilitation in species with differing tolerance to development: a landscape genetics study of native and introduced lizards

Aim: The development of natural habitats into urban land uses has greatly accelerated in the recent past due to human activities. This habitat development disrupts species’ natural dispersal processes and can lead to both direct and indirect impacts on dispersal. Whether human activities result in restricted or facilitated dispersal may depend on a species’ development tolerance; however, this premise has not been tested. We examined the impact of urbanization and road networks on the dispersal of three lizard species in the context of their development tolerance.
Location: Curaçao
Methods: To quantify species’ development tolerance, we modelled three lizard species abundances at sites based on surrounding landscape development. Using microsatellite genotypes, we conducted individual-based resistance surface analyses and modelled the effect of habitat development on genetic admixture to assess indirect dispersal restriction and facilitation. We explored direct facilitation of dispersal ..., Lizard surveys were conducted across the Caribbean Island of Curacao from January 27 - March 11, 2017. Tail tips were collected for DNA extraction from 100 Phyllodactylus martini, 100 Anolis lineatus, and 95 Hemidactylus mabouia. 
Samples from P. martini and A. lineatus were genotyped with 11 new polymorphic microsatellite markers each (Genetic Marker Services, Hassocks, UK). See Supplemental materials of associated paper for marker details. We genotyped H. mabouia using 12 known polymorphic markers (Short & Petren, 2008). Mitochondrial DNA from cytochrome b was amplified using primers MTA-S:F (5’ ATCTCAGCATGATGAAACTTCG 3’) and MTF-S:R (5’ TTT GGTTTACAAGACCAATG 3’) for P. martini  and A. lineatus (Thorpe et al., 2008) and primers rGlu-1L:F (5’ GAAAAACCRCCGTTGTWATTCAACTA 3’) and rPro-1H3:R (5’ TWAAAATKCTAGTTTTGGG 3’) for H. mabouia (Kumazawa & Endo, 2004)., , # Data from: dispersal restriction and facilitation in species with differing tolerance to development: a landscape genetics study of native and introduced lizards

[https://doi.org/10.5061/dryad.w9ghx3fvz](https://doi.org/10.5061/dryad.w9ghx3fvz)

This dataset includes genetic and spatial data relevant to three lizard species on the island of Curacao. *Phyllodactylus martini* is a native gecko, *Anolis lineatus* is a native anole, and *Hemidactylus mabouia* is an invasive gecko. Lizards were sampled at developed and undeveloped sites across the island. We genotyped all three species with at least 11 microsatellite markers and sequenced a section of mitochondrial DNA from cytochrome b.

## Description of the data and file structure

Microsatellite_Genotypes.xlsx - contains microstallite genotypes for successfully amplified primers used in the final analysis for each lizard species (*P. martini*, *A. lineatus*, and *H. mabouia*). Each species is displayed on a separate sheet of Excel boo...