18S V9 metabarcoding reference databases and naive-bayes classifier
收藏资源简介:
18S metabarcoding databases and naive-bayes classifiers specific to the V9 region. Built from the PR2 database using Qiime2 (version 2023.2). Includes a naive-bayes classifier for use with Qiime2. Sequences were dereplicated with Rescript --p-mode 'uniq' , retaining identical sequence records that have differing taxonomies. Primers used: EMP 18S 1391f: GTACACACCGCCCGTC EMP 18S EukBr: TGATCCTTCTGCAGGTTCACCTAC Stats 19,470 unique sequences 39,170 total sequences 11,748 unique taxa Note: there were 221,085 sequences in the original PR2 database. Many were filtered out due to the in-silico extraction with our V9 primers. File Descriptions Files in bold are recommended for taxonomic classification. Create naive-bayes classifier for 18S PR2 database.md: Markdown with code used to generate databases | pr2_v5.0.0_SSU_18S-V9_uniq-classifier.qza: Unweighted naive-bayes classifier for 18S V9 (primers 1391f, EukBr), extracted from PR2 v5.0.1, dereplicated, generated by qiime2-2023.2 | pr2_version_5.0.0_SSU_18S-V9_uniq_seqs.qza: Sequences for 18S V9 (primers 1391f, EukBr), extracted from PR2 v5.0.1, dereplicated, generated by qiime2-2023.2 | pr2_version_5.0.0_SSU_18S-V9_uniq_tax.qza: Taxa for pr2_version_5.0.0_SSU_18S-V9_uniq_seqs.qza (dereplicated) | pr2_version_5.0.0_SSU_18S-V9_seqs.qza: Sequences for 18S V9 (primers 1391f, EukBr), extracted from PR2 v5.0.1, NOT dereplicated, generated by qiime2-2023.2 | pr2_version_5.0.0_SSU_18S-V9_tax.qza: Taxa for pr2_version_5.0.0_SSU_18S-V9_seqs.qza (NOT dereplicated) pr2_version_5.0.0_SSU_mothur.fasta: SSU sequences downloaded from PR2 v 5.0.1 | pr2_version_5.0.0_SSU_mothur.tax: SSU taxa downloaded from PR2 v5.0.1 | pr2_version_5.0.0_taxonomy.xlsx: Detailed taxonomy downloaded from PR2 v5.0.1 |



