Seasonal survey of bacteria and Methylobacterium diversity associated with the phyllosphere of temperate forests in the province of Quebec, Canada.

Bacteria diversity associated with the phyllosphere in two forests in the province of Quebec, Canada: Mont Saint Hilaire (MSH) and Station biologique des Laurentides (SBL). Fifty-two trees were sampled 3-4 times from June to October 2018 in both MSH and SBL. Bacterial community diversity was assessed with the 16S RNA ribosomal gene (targeting V5-V6 regions) by Illumina barcoding sequencing for 48 samples (46 leaf samples, 1 positive control, 1 negative control). Methylobacterium (Bacteria, Proteobacteria, Alphaproteobacteria, Rhizobiales, Methylobacteriaceae) community diversity was assessed with the rpoB gene by Illumina barcoding sequencing (184 leaf samples, 4 positive controls, 4 negative controls), using primers Met02-352-F (AAGGACATCAAGGAGCAGGA) and Met02-1121-R (ACSCGGTAKATGTCGAACAG) specific to Methylobacteriaceae.