rCRUX Generated MiFish Universal 12S Expanded Reference Database
收藏资源简介:
rCRUX generated reference database using NCBI nt blast database and an additional custom blast database comprised of all Actinopterygii mitogenomes. Both blast databases were downloaded in December 2022. Primer Name: MiFish Universal Gene: 12S Length of Target: 163–185 get_seeds_local() minimum length: 170 get_seeds_local() maximum length: 250 blast_seeds() minimum length: 140 blast_seeds() maximum length: 250 max_to_blast: 1000 Forward Sequence (5'-3'): GTGTCGGTAAAACTCGTGCCAGC Reverse Sequence (5'-3'): CATAGTGGGGTATCTAATCCCAGTTTG Reference: Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. https://doi.org/10.1098/rsos.150088 We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.



