Low levels of genetic differentiation with isolation by geography and environment in populations of Drosophila melanogaster from across China
收藏资源简介:
The fruit fly Drosophila melanogaster is a model species in evolutionary studies. However, the population processes of this species in East Asia are poorly studied, even though this area was one of the first regions colonized outside of its native distribution range. Here we examined the population genetic structure of D. melanogaster across China. There were 14 mitochondrial haplotypes with ten unique ones out of 23 known from around the globe. Pairwise FST values estimated from 15 novel microsatellites ranged from 0 to 0.11, with geographically isolated populations showing the highest level of genetic uniqueness. STRUCTURE analysis identified high levels of admixture at both the individual and population levels. Mantel tests indicated a strong association between genetic distance and geographical distance as well as environmental distance. Full RDA analysis showed that independent effects of environmental conditions and geography accounted for 62.10% and 31.58% of the total explained genetic variance, respectively. When geographic variables were constrained in a partial RDA analysis, three environmental variables of bio2 (mean diurnal air temperature range), bio13 (precipitation of the wettest month), and bio15 (precipitation seasonality) were correlated with genetic distance. Our study suggests that a high level of gene flow, geographical isolation, and environmental factors have together shaped the population genetic structure of D. melanogaster after its introduction into China. Methods Sample collection and DNA extraction Specimens of D. melanogaster were collected from 16 locations in China were trapped by using rotten fruits (e.g., grapes, watermelon and banana) in the year 2019 (Table 1; Fig. 1). The sampled flies were firstly checked morphologically using an anatomical lens, followed by molecular identification by BLAST searching of the mitochondrial cytochrome oxidase subunit I (cox1) gene (see below) against the nucleotide database (nt) and in the BOLD system (http://www.boldsystems.org) to ensure the reliability of morphological identification. All samples were stored in 98% alcohol, and frozen at −80 °C before DNA extraction. A DNeasy Blood and Tissue Kit (Qiagen, Germany) was used to extract total genomic DNA individually for 330 samples randomly selected from 16 populations. Mitochondrial gene amplification and sequencing To characterize the mitochondrial variation and validate correct identification of the specimens, a fragment of the cox1 gene involving the DNA barcoding region of insects was sequenced using the universal primer pairs AF (5’ GGTCAACAAATCATAAAGATATTGG 3’) and AR (5’ TAAACTTCAGGGTGACCAAAAAATCA 3’) (Folmer et al, 1994). Polymerase chain reaction (PCR) was conducted using the Mastercycler Pro system (Eppendorf, Germany) under standard conditions with an annealing temperature of 52 °C. PCR components were added as recommended by the manufacturer of Takara LA Taq (Takara Biomedical, Japan). Amplified products were purified and sequenced on an ABI 3730xl DNA Analyzer by TianYi HuiYuan Biotechnology Co. Ltd (Beijing, China). Microsatellite marker development and genotyping We developed genome-wide microsatellites from the D. melanogaster genome (accession PGRM00000000). The QDD3 program (Meglecz et al, 2010) was used to extract microsatellites along with their flanking sequences (300 bp each) from the scaffolds, and to design the primers. According to previous reports, dinucleotide microsatellites are prone to polymerase slippage during the amplification process, which may lead to mistyping, so muti- (including tri-, tetra-, penta- and hexa-) nucleotide loci were preferentially selected in this study. The criteria and parameters of primer design for the isolated microsatellite markers followed Cao et al (2016a). Next, the output primers were further filtered manually using more stringent criteria: (i) only perfect (without repeat region interruptions) loci were retained; (ii) the minimum distance between the 3′ end of two primer pairs and their target region had to be >10 bp; and (iii) primers using the ‘A’ design strategy that do not have multiple microsatellites, nanosatellites, or homopolymers in the amplicon were retained. A total of 60 primer pairs were ultimately screened out, which were used for further isolation of polymorphic microsatellite loci. The sixty primer pairs were initially chemically synthesized by Tsingke Biotechnology Co. Ltd (Beijing, China), with a universal primer (CAGGACCAGGCTACCGTG) added to the 5′ end of the forward primers based on the method of Blacket et al (2012). One individual D. melanogaster from each of the 16 populations was randomly selected to test the polymorphism level of target microsatellite sequences and the amplification efficiency of synthesized primers. The PCR amplification reaction was carried out in a 10 μL volume consisting of 0.5 µL of template DNA (5-20 ng/µL), 5 µL of Master Mix (Promega, Madison, WI, USA), 0.08 µL of PC tail modified forward primer (10 mM), 0.16 µL of reverse primer (10 mM), 0.32 µL of fluorescence-labeled PC tail (10 mM), and 3.94 µL of ddH2O. The thermal profiles for DNA amplification were as follows: 4 min at 94 °C; 35 cycles of 30 s at 94 °C, 30 s at 56 °C, and 45 s at 72 °C, followed by a final 10-min extension at 72 °C. The amplified PCR fragments were analyzed on an ABI 3730xl DNA Analyzer (Applied Biosystems) using the GeneScan 500 LIZ size standard (Applied Biosystems). Genotyping was conducted using GENEMAPPER 4.0 (Applied Biosystems, USA). Primer pairs that failed in the PCR amplification for more than two individuals, that were monomorphic in testing individuals, or that produced more than two peaks were discarded (Table 2).



