Disentangling the components of coastal fish biodiversity in southern Brittany by applying an environmental DNA (eDNA) approach.

Data
acquisition

During
three days, from September 8th to September 10th 2020, we sampled 17
stations whose 13 - located near to the coast - as transects and 4 -
located deeper - as fixed points. For each station, we performed two
water filtration replicates in parallel on each side of the
boatcorresponding to a total of 34 filters for the whole area. We
followed a precise protocol to sample eDNA based on material composed
of an Athena® peristaltic pump, a VigiDNA® 0.22 µM cross‐flow
filtration capsule making it possible to filter a large water volume
of 30L and disposable sterile tubing for each filtration capsule. At
the end of each filtration, the water inside the capsules was emptied
and filled with 80 ml of CL1 conservation buffer and stored at room
temperature. To avoid any contamination, we carried out all the
sampling steps using disposable gloves and single-use filtration
equipment.

edNA
extraction, amplification and sequencing

DNA
extraction, amplification and high-throughput sequencing were
performed in distinct dedicated rooms set up with positive air
pressure, UV treatment and frequent air renewal. After the DNA
extraction, we tested the samples for inhibition following the
protocol described in Biggs et al., (2015). If the sample was
considered inhibited, it was diluted 5-fold before the amplification.
DNA amplifications were performed in a final volume of 25 μL, using
3 μL of DNA extract as the template. The amplification mixture
contained 1 U of AmpliTaq Gold DNA Polymerase (Applied Biosystems,
Foster City, CA), 10 mM Tris-HCl, 50 mM KCl, 2.5 mM MgCl2, 0.2 mM
each dNTP, 0.2 μM of each primers, 4 µM human blocking primer and
0.2 µg/µL bovine serum albumin (BSA, Roche Diagnostic, Basel,
Switzerland). To perform the amplification we used the teleo primer
(forward: ACACCGCCCGTCACTCT, reverse: CTTCCGGTACACTTACCATG) that
amplify a region of c.a. 60 bases pair of mitochondrial 12S region.
This primer pair was designed to capture teleosteans taxa (Valentini
et al., 2016) but also capture Elasmobranchii taxa (Polanco-Fernández
et al., 2021b). The “teleo” primers were 5’-labeled with an
eight-nucleotide tag unique to each PCR replicate (with at least
three differences between any pair of tags), allowing the assignment
of each sequence to the corresponding sample during sequence
analysis. The tags for the forward and reverse primers were identical
for each PCR replicate. The PCR mixture was denatured at 95°C for 10
min, followed by 50 cycles of 30 s at 95°C, 30 s at 55°C and 1 min
at 72 °C and a final elongation step at 72°C for 7 min. Twelve
replicates of PCRs were run per filtration (i.e., 24 per sampling
site). After amplification, the samples were titrated using capillary
electrophoresis (QIAxcel; Qiagen GmbH) and purified using the
MinElute PCR purification kit (Qiagen GmbH). Before sequencing,
purified DNA was titrated again using capillary electrophoresis. We
pooled the purified PCR products in equal volumes to achieve a
theoretical sequencing depth of 1 000,000 reads per sample. Library
preparation and sequencing were performed at Fasteris (Geneva,
Switzerland). Two libraries were prepared using the MetaFast protocol
and the paired-end sequencing (2x125 bp) was carried out using
on a MiSeq (2x125 bp, Illumina, San Diego, CA, USA) and the MiSeq
Flow Cell Kit Version3 (Illumina, San Diego, CA, USA) were used
following the manufacturer’s instructions. Two negative extraction
controls and one negative PCR control (ultrapure water) were
amplified (12 replicates as well) and sequenced in parallel to the
samples to monitor possible contaminants.