seqAll_mixEUK

Demultiplexing file from MiSEQ sequencing (2 x 250 bp) of a
Mock community (16 species) amplifiying with the following primers:
960F: GGCTTAATTTGACTCAACRCG
1419R: GGGCATCACAGACCTGTTAT

For obtaining this file, the paired-end reads were merged together
using UPARSE tools (option -fastq_mergepairs with a
minimal overlap equal to 150 and no mismatch allowed) (Edgar, 2013).
and the merged sequences were then submitted to the
following cleaning procedures:
(i) no undefined bases (Ns), (ii) a minimum sequence length of 200 bp,
and (iii) no sequencing error in the
forward and reverse primers.

Composition of the mock community:
A50 Eukaryota;Rhizaria;Cercozoa;
A31 Eukaryota;Alveolata;Perkinsea;
A54 Eukaryota;Cryptophyceae
A34 Eukaryota;Stramenopiles;Chrysophyceae;
A44 Eukaryota;Fungi;
PG5-14 Eukaryota;Archaeplastida;Chloroplastida;Chlorophyta;Chlorophyceae
PG5-26 Eukaryota;Alveolata;Ciliophora;
PG5-28 Eukaryota;Fungi;Cryptomycota;
BI109 Eukaryota;Fungi;Cryptomycota; (LKM11 clade)
B24 Eukaryota;Stramenopiles;Bicosoecida;
B64 Eukaryota;Fungi;Chytridiomycota;
B79 Eukaryota;Fungi;Dikarya;
B26 Eukaryota;Alveolata;Perkinsozoa
BA97 Eukaryota;Cryptophyta;
B36 Eukaryota;Stramenopiles;Ochrophyta;Chrysophyceae;
BA231 Eukaryota;Alveolata;Ciliophora;Alveolate_1;