Optimizing detectability of the endangered fan mussel using eDNA and ddPCR

Spatial and temporal monitoring of species threatened with extinction is of critical importance for conservation and ecosystem management. On the Mediterranean coast, the fan mussel (Pinna nobilis) is listed as critically endangered after suffering from a mass mortality event since 2016, leading to 100% mortality in most marine populations. Conventional monitoring for this macroinvertebrate is done using scuba, which is challenging in dense meadows or with low visibility. Here we developed an environmental DNA assay targeting the fan mussel and assessed the influence of several environmental parameters on the species detectability in situ. We developed and tested an eDNA molecular marker and collected 48 water samples in two sites at the Thau lagoon (France) with distinct fan mussel density, depths, and during two seasons (summer and autumn). Our marker can amplify fan mussel DNA but lacks specificity since it also amplifies a conspecific species (Pinna rudis). We successfully amplified...,
Assay development

Reference sequences on the mitochondrial genome were downloaded for P.nobilis and co-occurring related species of the same family (Pinna rudis and Atrina fragilis) from EMBL (Kanz et al. 2005), and aligned using Geneious Prime 2020 (https://www.geneious.com/). Primer selection was done by maximizing specificity on the binding sites for the target species while maximizing the number of mismatches of ligation sites of closely related species. Primers were designed manually with the assistance of the primer3 algorithm on Geneious and amplified a sequence insert of ~202 bp on the mitochondrial COI gene for P.nobilis (Supl Mat Table S1), the full amplified sequence being ~243 pb. The selected primer pair (PN_COI_M15; forward-TCAGCTTTTGTAGAGGGCGG; reverse- AGAGACTACCAACAGCACAGC) was also tested on the entire NCBI database using in-silico PCR with the ecoPCR software (Boyer et al., 2016) allowing up to 3 mismatches on each primer (so 6 in total), to verify the absence of un..., , # Optimizing detectability of the endangered fan mussel using eDNA and ddPCR

This repository contains data and code to reproduce the analyses and produce the figures from Marques et al. (2023) Optimizing detectability of the endangered fan mussel using eDNA and ddPCR

## Content

### Data

Contains all data needed to reproduce analyses and figures

* 📁 **data/data_pinna_clean.csv**: contains field and ddPCR data for all samples considered in the analysis
Spygen_ID: is the individual code for the eDNA sample
Site: site name
Depth: Depth of sampling [m]
Replicat: Replicat of sample
ncopies.ddPCR[1-3]: number of copies detected for each of the three replicates of ddPCR [copies/uL]
date_clean: date in format DD.MM.YYYY
Month: Month number
season: Season
Sampling: Sampling period (either 1 or 2, for summer or autumn)
ddPCR_count_sum: number of detections over the three ddPCR replicates

* 📁 **data/v_COI_M15.ecopcr**: contains the output of an *in ...