"RNA-Seq raw data of two maize near isogenic lines (NILs), NIL16 and NIL95, under infestation with Sesamia nonagrioides and control conditions"

The original raw data from Illumina platform were transformed to Sequenced Reads, known as Raw Data or RAW Reads, by base calling. Raw data are recorded in a FASTQ file, which contains sequencing reads and corresponding sequencing quality. Every read in FASTQ format is stored in four lines, as indicated below: @HWI-ST1276:71:C1162ACXX:1:1101:1208:2458 1:N:0:CGATGT NAAGAACACGTTCGGTCACCTCAGCACACTTGTGAATGTCATGGGATCCAT + #55???BBBBB?BA@DEEFFCFFHHFFCFFHHHHHHHFAE0ECFFD/AEHH Line 1 begins with a '@' character and is followed by the Illumina Sequence Identifiers and an optional description. The details of Illumina sequence identifier are listed in the table below. Identifier Meaning HWI-ST1276 Instrument – unique identifier of the sequencer 71 Run number – Run number on instrument C1162ACXX Flow Cell ID – ID of flow cell 1 Lane Number – positive integer 1101 Tile Number – positive integer 1208 X – x coordinate of the spot. Integer which can be negative 2458 Y – y coordinate of the spot. Integer which can be negative 1 Read number. 1 can be single read or Read 2 of paired-end. N Y if the read is filtered (did not pass), N otherwise. 0 Control number - 0 when none of the control bits are on, otherwise it is an even number CGATGT Illumina index sequences Line 2 is the raw sequence of the read. Line 3 begins with a '+' character and is optionally followed by the same sequence identifiers and descriptions as in Line 1. Line 4 encodes the quality values for the bases in Line 2 and contains the same number of characters as the bases in the read.