Novel variations of D genes validated using genomic data from human, camel, rhesus macaque, mouse, rat, and rabbit datasets.

“Original” refers to the sequence in the IMGT database. In three of the inferred sequences, there is an extra nucleotide at the end that was not found in the genomic reads, e.g., the novel variation inferred from mice datasets TTTATTACTACGATGGTAGCTACg is only present as TTTATTACTACGATGGTAGCTAC in the genomic reads. Other polymorphisms that were found using genomic validation of the inferred genes are underlined. For example, GATACAGCGGGTACAGT was inferred by MINING-D as a variant of the macaque gene IGHD5S3*01, but the whole sequence GGGGATACAGCGGGTACAGTTAC was found in the genomic reads.