rCRUX Generated MiDeca Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.

Primer Name:  MiDeca
Gene:   16S
Length of Target:    154-184
get_seeds_local() minimum length:    105
get_seeds_local() maximum length:    230
blast_seeds() minimum length:    66
blast_seeds() maximum length:    191
max_to_blast:  50
Forward Sequence (5'-3'):   GGACGATAAGACCCTATAAA
Reverse Sequence (5'-3'):    ACGCTGTTATCCCTAAAGT
Reference:   Komai, T., Gotoh, R.O., Sado, T. and Miya, M., 2019. Development of a new set of PCR primers for eDNA metabarcoding decapod crustaceans. Metabarcoding and Metagenomics, 3, p.e33835. https://doi.org/10.3897/mbmg.6.76534

We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.