rCRUX Generated MiDeca Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name: MiDeca Gene: 16S Length of Target: 154-184 get_seeds_local() minimum length: 105 get_seeds_local() maximum length: 230 blast_seeds() minimum length: 66 blast_seeds() maximum length: 191 max_to_blast: 50 Forward Sequence (5'-3'): GGACGATAAGACCCTATAAA Reverse Sequence (5'-3'): ACGCTGTTATCCCTAAAGT Reference: Komai, T., Gotoh, R.O., Sado, T. and Miya, M., 2019. Development of a new set of PCR primers for eDNA metabarcoding decapod crustaceans. Metabarcoding and Metagenomics, 3, p.e33835. https://doi.org/10.3897/mbmg.6.76534 We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.