Table II. – A in Eleotris (Teleostei: Eleotridae) of the Indian Ocean: an overview with the description of three new species

Table II. – A: Primers. B: Pairwise distance matrix (percentage of divergence between Eleotris paired individuals) based on the 79 bp of the cytochrome c oxidase subunit (COI). C: List of the 17 diagnostic nucleotide substitutions found in the 79 bp of the cytochrome c oxidase subunit (COI) between the eight species of Eleotris. GenesPrimer nameSequence (5í-3í)PublicationCOITel F1TCGACTAATCAYAAAGAYATYGGCACDettai et al., 2011COITel R1ACTTCTGGGTGNCCAAARAATCARAADettai et al., 2011COI1FGTGGCAATCACGCGCTGATTTTTCTCAACPresent studyCOI130RATTTGGTCGTCTCCTAGTAGGGCACCAGGPresent study