Identification of system-level features in HIV migration within a host

Blood and tissue samples were collected during a rapid autopsy procedure. Genomic DNA was extracted from 5 million PBMCs and snap-frozen tissues using QIAamp DNA Mini Kit (Qiagen cat#51306) per manufacturer's protocol. After extraction, precipitation was performed to concentrate DNA. RNA was extracted from blood plasma layering 500-700µl of plasma on top of 200µl of 20% sterile filtered sucrose solution. Sample was spun at 23,500xg for 1 hour at 4°C to pellet the virus. Supernatant was removed and the pellet resuspended in 140µl of PBS. RNA was extracted using Qiagen’s QIAamp Viral RNA mini kit (cat# 52904) according to the manufacturer’s recommendation. cDNA from HIV RNA was generated using Bio-Rad One-Step RT-ddPCR Advanced Kit for Probes (cat# 186-4021). Nested PCR. To amplify single genome FL env, DNA extracted from antemortem PBMCs and post-mortem tissues was diluted using ddPCR quantification data. This limited dilution PCR reaction can prevent PCR recombination and ambiguous base calls and allow the amplification of viral single genomes. For HIV RNA in blood plasma, cDNA was generated from RNA using SuperScript III First Strand Synthesis System (cat# 18080-051). Template cDNA and HIV DNA extracted from tissues were diluted until approximately 30% of the second-round reactions were positive for the correctly-sized amplification product. Primers used for the first round were 5’FENVouter (forward) TTAGGCATCTCCTATGGCAGGAA and 3’RENVouter (reverse) TCTTAAAGGTACCTGAGGTCTGACTGG. First round PCRs were performed using the Advantage 2 PCR Kit from Takara (cat# 639206) following manufacturer’s recommendations using the 10X SA Buffer. Cycling conditions were 95C for 1 min, 35 cycles of 95C 15sec, 57C 30sec, 68C 3min with a final extension at 68C for 10min.The second round PCR was done using 5’FENVinner: GAGCAGAAGACAGTGGCAATGA (forward) and 3’RENVinner: CCACTTGCCACCCATBTTATAGCA (reverse). Cycling conditions were 95C for 1 min, 30 cycles of 95C 15sec, 64C 30sec, 68C 3min with a final extension at 68C for 10min. PCR clean ups were done on the second round reaction products using QIAquick PCR Purification Kit (cat# 28106). DNA was quantified using Qubit dsDNA HS Assay Kit (Invitrogen cat#Q32854). Quality and integrity were measured using Genomic DNA Screen Tape in combination with the 2200 TapeStation System (Genomic DNA Reagents cat#5067-5366, Genomic DNA Screen Tape Cat #5067-5365). Nextera XT Library Preparation. Single Genome amplicons were prepared for deep sequencing using the Nextera XT DNA Library Preparation Kit (Illumina FC-131-1096) with indexing of 96-samples per run (Nextera XT index kit set A FC-131-2001) per manufacturer’s protocols.