遇见数据集

Orthogonal transcriptional modulation and gene editing using multiple CRISPR/Cas systems

收藏
NIAID Data Ecosystem2026-05-02 收录
官方服务:

资源简介:

CRISPR/Cas-based transcriptional activation (CRISPRa) and interference (CRISPRi) enable transient programmable gene regulation by recruitment or fusion of transcriptional regulators to nuclease-deficient Cas (dCas). Here we expand on the emerging area of transcriptional engineering and RNA delivery by benchmarking combinations of RNA-delivered dCas and transcriptional modulators. We utilize dCas9 from Staphylococcus aureus and Streptococcus pyogenes for orthogonal transcriptional modulation to upregulate one set of genes while downregulating another. We also establish trimodal genetic engineering by combining orthogonal transcriptional regulation with gene knockout by Cas12a (Acidaminococcus; AsCas12a) ribonucleoprotein (RNP) delivery. To simplify trimodal engineering, we explore optimal parameters for implementing truncated sgRNAs to make use of SpCas9 for knockout and CRISPRa. We find the Cas9 protein:sgRNA ratio to be crucial for avoiding sgRNA cross-complexation and for balancing knockout and activation efficiencies. We demonstrate high efficiencies of trimodal genetic engineering in primary human T cells while preserving basic T cell health and functionality. This study highlights the versatility and potential of complex genetic engineering using multiple CRISPR/Cas systems in a simple, one-step process yielding transient transcriptome modulation and permanent DNA changes. We believe such elaborate engineering can be implemented in regenerative medicine and therapies to facilitate more sophisticated treatments. Methods Plasmid cloning All plasmids were designed based on a backbone suitable for in vitro mRNA transcription previously described in Jensen et al. (2021).22 This plasmid contains a T7 promotor followed by a 45bp 5’UTR ending with a Kozak sequence after which the GOI is inserted. The GOI is followed by a 93bp 3′ UTR of the murine Hba-a1 gene and a 50nt poly A tail and a unique restriction site for run-off IVT. The GOIs for CRISPRa experiments were as follows: dSpCas9-VPR from Jensen et al. (2021), dSpCas9 for dSpCas9-VPRmini and dSpCas9-p65p3-HSF1 was amplified from the dSpCas9-VPR plasmid.22 VPRmini was amplified from Addgene plasmid 99698. pAAV-SCP1-dSa VPR mini.-2X snRP-1 BsaI gRNA was a gift from George Church (Addgene plasmid # 99698 ; http://n2t.net/addgene:99698 ; RRID:Addgene_99698). sp65p3-HSF1 was amplified from Addgene plasmid 129136. pCE059-SiT-Cas12a-[Activ] was a gift from Randall Platt (Addgene plasmid # 128136 ; http://n2t.net/addgene:128136 ; RRID:Addgene_128136). dSpCas9-SunTag_10x amplified from Addgene plasmid 107310. dSV40-NLS-dCas9-HA-NLS-NLS-10xGCN4 was a gift from Hui Yang (Addgene plasmid # 107310 ; http://n2t.net/addgene:107310 ; RRID:Addgene_107310). scFv-GCN4-VPR, scFv-GCN4-VPRmini, and scFv-GCN4-sp65p3-HSF1 were synthesized by Twist Bioscience. scFv-GCN4-VP64 was amplified from Addgene plasmid 60904. pHRdSV40-scFv-GCN4-sfGFP-VP64-GB1-NLS was a gift from Ron Vale (Addgene plasmid # 60904 ; http://n2t.net/addgene:60904 ; RRID:Addgene_60904). CRISPRi IVT template plasmid were produced as follows: KOX1-dSpCas9 was from Jensen et al. (2021) (as KRAB-dSpCas9) (Addgene plasmid # 205248 ; http://n2t.net/addgene:205248 ; RRID:Addgene_205248). dSpCas9-KOX1-MeCP2 was amplified from Addgene plasmid 110821 (as dCas9-KRAB-MeCP2). dCas9-KRAB-MeCP2 was a gift from Alejandro Chavez & George Church (Addgene plasmid # 110821 ; http://n2t.net/addgene:110821 ; RRID:Addgene_110821). ZIM3-dSpCas9 was amplified from Addgene plasmid 154472. pLX303-ZIM3-KRAB-dCas9 was a gift from Mikko Taipale (Addgene plasmid # 154472 ; http://n2t.net/addgene:154472 ; RRID:Addgene_154472). dSaCas9-KOX1 was amplified from Addgene plasmid 106219. AAV CMV-dSaCas9-KRAB-bGHpA was a gift from Charles Gersbach (Addgene plasmid # 106219 ; http://n2t.net/addgene:106219 ; RRID:Addgene_106219). dSaCas9 for dSaCas9-KOX1-MeCP2 and dSaCas9-ZIM3 was also amplified from Addgene plasmid 106219. dSpCas9 without effector fusion was amplified from the dSpCas9-VPR plasmid and dSaCas9 without effector fusion was amplified from Addgene plasmid 106219. All plasmids and their respective sequences are listed in Table S1. Primers contained at least 30 bp compatible overhangs with the backbone for Gibson cloning. All primers were ordered from Sigma Aldrich (Merck) and are listed in Table S2. Amplification of GOIs were performed using the Phusion Green Hot Start II High-Fidelity PCR Master Mix (Thermo Fisher Scientific) according to the manufacturer’s instructions. Non-template controls were included for all reactions. GOIs were purified from a 1% agarose gel using the GeneJet Gel Extraction Kit (Thermo Fisher Scientific) following the supplier’s instructions. The assembly of PCR fragments and linearized IVT vector were conducted using the NEBuilder HiFi DNA Assembly (New England BioLabs) using recommended ratios of insert to vector as well as incubation times provided by the supplier. The assembled products were then transformed into 10-beta Competent E. coli (New England BioLabs), and finally, purified using NucleoBond Extra Midi EF (MACHERY-NAGEL). All plasmid constructs were confirmed by Sanger sequencing (Eurofins Genomics and Macrogen) or whole-plasmid sequencing using the Oxford Nanophore technology. In vitro transcription IVT mRNA was generated as previously described by Jensen et al. (2021), with the following modifications: For the IVT reaction, uridine was substituted with N1-methyl-pseudouridine (Jena Bioscience) and with a CleanCap:GTP ratio of 0.8:1. The mRNA was purified and concentrated using the RNA Clean & Concentrator kit (Zymo Research) according to the manufacturer’s manual. The mRNA quantity was verified using the DeNovix DS-11 Series spectrophotometer, and the RNA quality was verified on an Agilent 2100 Bioanalyzer (Agilent Technologies) using the RNA 6000 Nano Kit (Agilent Technologies) and accompanying protocol. sgRNAs The sgRNAs for the s. pyogenes Cas9 system were ordered from Synthego as chemically modified sgRNAs containing 2’-O-methyl on the three terminal nucleotides at both ends and 3’phosporothioate between the first three and last two bases.21 sgRNAs for the s. aureus Cas9 system were synthesized by either Synthego or SBS Genetech Co. with 2’-O-methyl and 3’ phosphorothioate on the three terminal nucleotides at both ends. Spacer sequences are listed in Table S3. The sgRNA design for CRISPRa and CRISPRi experiments were based on guidelines previously devised by Gilbert et al. (2014) and Sanson et al. (2018), and with at least 30 bp between adjacent protospacer sequences wherever possible due to PAM abundance.16,49 TRAC sgRNAs for SpCas9 is from Wieking et al. (2020) and TRAC crRNA for AsCas12a is from Kath et al. (2022).29,30 Cell culture Jurkat cells were cultured in RPMI-1640 medium supplemented with 5% heat-inactivated FCS, 2mM L-glutamine, 100 U/mL penicillin, and 100 ug/mL streptomycin. Peripheral-blood mononuclear cells (PBMCs) were isolated from de-identified buffy coats obtained from healthy adult donors from the Aarhus University Hospital Blood Bank by Ficoll-Plaque plus density gradient and from these, primary human T cells were purified by negative selection with the EasySep human T cell isolation kit (StemCell Technologies). The primary human T cells were cultured in X-VIVO 15 media (Lonza) supplemented with 5% human albumin serum (merck), and 10 ng/mL IL7 and IL2 (Peprotech). The cells were activated for 3 days with Dynabeads human T-activator CD3/CD28 (Thermo Fisher Scientific) at a 1:1 cell to bead ratio. All cells were counted on a Bio-Rad TC20 automated cell counter using tryphan blue to exclude dead cells. Electroporation All cells were electroporated using the 4D-nucleofector device from Lonza (X unit) in 20-µL-format Nucleocuvette strips. Cells were electroporated in the following electroporation buffers and programs: Jurkat cells: Opti-MEM (Thermo Fisher Scientific), CM138-P3; primary human T cells: solution 1 M, EO115-P3.50 For CRISPRa and CRISPRi singleplex RNA-based delivery experiments, unless otherwise specified, cells were electroporated with 0.095 µg/µL mRNA + 0.05 µg/µL of each of the sgRNAs. For orthogonal CRISPRa and CRISPRi experiments, cells were electroporated with 0.095 µg/µL dSpCas9-VPR mRNA along with 0.0125 µg/µL of each sgRNA for CD123 (#1-4) and NGFR (#1-4), and 0.095 µg/µL dSaCas9-KOX1 mRNA along with 0.0167 µg/µL of each sgRNA for CD5 (#1-3) and CD3E (#1-3). In primary human T cells for CRISPRa and CRISPRi experiments for trimodal engineering, at the optimized condition cells were electroporated with 0.095 µg/µL dSpCas9-VPR mRNA+0.0125 µg/µL of each sgRNA for CD123 (#1-4) and 0.095 µg/µL dSaCas9-KOX1+0.05 µg/µL of each sgRNA for CD5 (#1-3). For gene editing of TRAC with nuclease-active Cas9 protein (IDT. Alt-R S.p. Cas9 Nuclease V3), Cas9 and sgRNAs were incubated for 15 min at room temperature, and later stored at 4°C prior to electroporation. RNP complexes were mixed with cells resuspended in 1 M electroporation buffer.51 Cas9 protein and sgRNAs were at a final concentration of respectively, 0.320 µg/µL and 0.160 µg/µL. Four days post-electroporation, genomic DNA was extracted for analysis of insertions or deletions (indels) using QuickExtract DNA extraction solution (Nordic Biolabs). The TRAC and CD123 genomic region covering the sgRNA target site(s) were PCR-amplified using the following primer pairs: (TRAC) Fw, 5’- ATCACGAGCAGCTGGTTTCT -3’; Rv, 5’-CCCGTGTCATTCTCTGGACT -3’, (CD123) Fw, 5’- ACTGTAACCTCCTCCGCCTC -3’; Rv, 5’-GATATCTTCCCGTGTGCGCT -3’. PCR products were either run on a 1% agarose gel and purified using the GeneJet Gel Extraction Kit (Thermo Fisher Scientific) or using an enzyme-based PCR clean-up method. 10 µL of post-PCR reaction mixture was mixed with 7 µL nuclease-free water, 0.5 µL Exonuclease I (Thermo Fisher Scientific, #EN0581) for a final concentration of 0.556U/µL and 0.5µL of FastAP Thermosensitive Alkaline Phosphatase (Thermo Fisher Scientific, #EF0651) for a final concentration of 0,0278U/µL. The reaction mixture was placed in a C1000 Thermal Cycler (Bio-Rad) running the following program: 37oC, 15 min., 80oC, 15 min. The purified PCR products were Sanger-sequenced (Eurofins Genomics) and the sequencing files were analyzed by ICE CRISPR analysis tool (Synthego) to validate indel formations using a mock-electroporated sample as a wildtype control. Flow cytometry Between 0.8 x 105 and 3 x 105 cells were collected and spun down at 300xg for 5 min. Cells were washed in PBS, and then stained with a viability dye for 30 min to exclude dead cells from the analysis. The cells were then washed in PBS, and resuspended in staining buffer (PBS, 2% FCS, 2mM EDTA). Cells were stained with fluorochrome-conjugated antibodies (Table S4) in concentrations recommended by the supplier, and then incubated for 30 min. The cells were analyzed by flow cytometry on a NovoCyte Quanteon 4025 flow cytometer equipped with four lasers (405 nm, 488 nm, 561 nm, and 637 nm) and 25 fluorescence detectors (Agilent, Santa Clara, Ca) or a CytoFLEX S flow cytometer equipped with four lasers (405 nm, 488 nm, 561 nm, and 638 nm) and 13 fluorescence detectors (Beckman Coulter, Brea, Ca). All flow cytometry experiments were individually compensated by individually stained compensation beads and analyzed in FlowJo (version 10.8.1). A representative gating scheme is shown in Figure S11. Surface marker-positive cells were gated based on combinations of unstained, viability stain only, or target knockout. For counting human T cells to assess proliferation, the cells were counted on the flow cytometer using CountBright absolute counting beads (Invitrogen). RNA-seq analysis Jurkat cells were electroporated in biological triplicates for each condition as described previously. The RNA amounts used for each condition in the electroporation mix were: (1) 0.095 µg/µL dSpCas9 + 0.095 µg/µL dSaCas9; (2) 0.095 µg/µL dSpCas9-VPR + 0.095 µg/µL dSaCas9-KOX1; and (3) 0.095 µg/µL dSpCas9-VPR + 0.095 µg/µL dSaCas9-KOX1 + 0.0125 µg/µL of each of the four sgRNA against CD123 and 0.0167 of each of the three sgRNA targeting CD5. Three days following incubation, the cells were lysed, and total RNA was purified using the ReliaPrep RNA cell miniprep system following the supplied protocol. The quality of the RNA was verified on a Bioanalyzer and thereafter sent to Novogene for the RNA sequencing workflow. Here, messenger RNA was purified from total RNA using poly-T oligo-attached magnetic beads. After fragmentation, the first strand cDNA was synthesized using random hexamer primers followed by second strand cDNA synthesis. The library was ready after end repair, A-tailing, adapter ligation, size selection, amplification, and purification. The library was checked with Qubit and real-time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries were pooled and sequenced on an Illumina NovaSeq X Plus. A minimum of 63M raw reads were obtained from each sample. Raw sequences were screened using fastqc (v0.12.1) to ensure high sequence quality. Reads were aligned to Genome Reference Consortium Human Build 38 patch release 14 (GRCh38.p14) using HISAT2 (v2.2.1). Quantification of transcripts was performed using Subread (v2.0.6). After quantification, the data was filtered to remove low-count features. We retained only those genes where at least one sample had a read count greater than 5. Differentially expressed genes were determined using DESeq2(v1.40.2) where statistically significance is classified by a p-value ≤ 0.05 and a log2FC > 2 or < -2 (Table S5). All the computing for this project was performed on the GenomeDK cluster. For off-target analysis, each of the four CD123 SpCas9 sgRNAs used for CRISPRa and each of the three CD5 SaCas9 sgRNAs used for CRISPRi were analyzed for potential off-targets in the genome using COSMID and CRISPOR (Table S5). The protospacer sequences were inputted and the default parameters were used. For COSMID, this allows up to 2 mismatches between the sgRNA and the protospacer or 1bp bulge in either the protospacer or in the sgRNA. For SaCas9 PAM, the more relaxed 5'-NNGRRN-3' PAM was used. For CRISPOR, up to 4 mismatches were allowed by default. Here, the canonical SaCas9 PAM 5'-NNGRRT-3' was used. The identified potential off-target sites were then checked to see if they were situated within a window of 10,000 bp of the TSS of any of the DEGs. TSSs were extracted using BioMart in Ensembl except for non-coding RNAs where TSSs were manually extracted using NCBI. Cell stimulation and ELISA Four days after electroporation with the trimodal CRISPR system, 500,000 primary human T cells from each donor were seeded into 96-well plates. Cells were stimulated with 25 ng/mL of phorbol 12-myristate 13-acetate (PMA) and 1 µg/mL ionomycin for a duration of 5 hours to induce cytokine production. Post-stimulation, cell culture supernatants were collected for cytokine quantification. TNF-α and IFN-γ concentrations were measured using the ELISA Max Deluxe Human TNF-α and IFN-γ kits, respectively (BioLegend). The experiment was conducted in technical duplicates or triplicates for each of the three T cell donors. Cytokine concentrations were interpolated from a standard curve, and supernatants were serially diluted to fit the assay's dynamic range. Statistics All statistical analyses were performed in GraphPad Prism (version 10.2.0). Statistical parameters are reported in the figure legends. Expression analyses were performed in biological triplicates unless otherwise specified. The significance of differences in multiple groups was determined by one-way or two-way analysis of variance (ANOVA) with Tukey’s multiple comparison’s test. P values < 0.05 was considered statistically significant. ns – nonsignificant (P > 0.05), * - P ≤ 0.05, ** - P ≤ 0.01, *** - P ≤ 0.001, **** - P ≤ 0.0001.

创建时间:
2024-11-27
二维码
社区交流群
二维码
科研交流群
商业服务