ROOL RNA nanocage (env-120) sequence fragment prediction via E8 lattice topological optimization

Target This record contains the predicted 3D structure of a ~900-nucleotide fragment of ROOL RNA nanocage (env-120), derived from the sequence used in PDB 9MDS. The prediction was generated using the E8 Navigator — a symmetry-based folding method originally designed for proteins but applied here directly to RNA nucleotides.GUUUAUAGACAUAGCCUUGUGUAUGACUGUCUAAUCAACAGUGCAAGGAAUUAGUUGUGCUCUCAAAAGGAGUUAUGUGAAGGAAAGAUUAAAUGGAUACAUUUAAUUAAGUACAAUUACUACAAAAUCUAUAAUGACUGGGUAAGUCACCCGUAAGAAGGAUGAGUUAGUAGAGAUAUAAUAAUAUCUUACAGUUCAACUGAUGUGCAAGUUUAUAAGUAGACGUAGUGUGAAAGACUUAUCGCUAACGCAAUAGACGUUAUCUCGAAAGGAUAAAAGAAACCAAGAAGAUAUACAAAUUGGUAACUUGUAUAAGCCCUUGGUAAUACCAAAUAAGUUAGUUCCUCAUGAUGUCGUGGAAACAUGACUAUAAGAUAAGUUGAAUUCGAUAGUAGCCCAAGAGGAAUCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNXGAUUGUGCCUUGAAAAAGGUGGGUGAGGUCUGUGGGUAAAAAUUAAUUCCCAUCUGGUUUUGGAUUUUCUUCGGAAAAUUGGUGCAAGAAGCGUGGAGUUGCUAACCAUUGCUCAGACUUGUAUCGCCAGUAGCACGAUAACGAUAUUUAUGAAUGUUGUAAGGUGAAUAAAAGCCUAUGAUUUGUGAACReference experimental structure: PDB 9MDS (cryo-EM, 3.10 Å resolution, 2025) Biological relevance ROOL (Rumen-Originating Ornate Large) RNA is a recently discovered (2025) large, ornate bacterial RNA that self-assembles into a protein-free multimeric nanocage — one of the most complex natural RNA-only quaternary structures known. It forms a symmetric, hollow cage larger than the ribosome, stabilized by kissing loops, A-minor interactions, an unusual A-A helix, and other intermolecular RNA contacts. These findings expand our understanding of RNA’s capacity for sophisticated self-assembly and have implications for RNA nanotechnology, synthetic biology, and evolutionary studies of the RNA world. Why this is a challenging folding problem ROOL RNA nanocage is extremely difficult to model: Large, multi-chain assembly (~4,784 modeled nucleotides total in PDB 9MDS) with high symmetry and long flexible loops Purely RNA-driven folding: relies on base-pairing, stacking, kissing loops, and metal-ion coordination — no protein component No full-length single-chain structure; experimental cryo-EM (2025) is one of the first high-resolution views of such ornate RNA-only cages Protein-focused predictors like AlphaFold cannot model RNA; RNA-specific tools are still maturing for large multimeric assemblies This makes ROOL a strong benchmark for testing whether symmetry-based methods can produce plausible RNA folds without domain-specific parameterization. Method: E8 Navigator The structure was generated using the E8 Navigator, a topology-driven folding engine that projects the input sequence onto the exceptional Lie group E8 lattice based on physicochemical properties. Folding is performed as symmetry-constrained optimization on the E8 manifold, guided by a holographic coherence metric (Ψ) and convergence to ultra-low error states — without multiple sequence alignments, neural networks, or patterns memorized from the PDB. Although developed for proteins, it was applied here to the RNA nucleotide sequence without modification. Results The output PDB (ROOL_env120_fragment_E8_prediction.pdb) converged with Ψ = 2.00 and very low final error (ERR: 0.00012159), producing a symmetric, cage-like assembly with a dense core and extended, interconnected loops — visually reminiscent of the nanocage topology in PDB 9MDS. No major steric clashes were observed. Significance ROOL RNA nanocage represents a landmark in RNA structural biology: a large, protein-free, symmetric assembly solved only recently (2025). The E8 method — originally protein-oriented — generated a coherent, cage-like fold from an RNA fragment without any RNA-specific rules. This demonstrates unexpected orthogonality and the emergence of complex RNA-like architecture from pure symmetry constraints. The prediction is shared openly for visualization, comparison with the experimental cryo-EM structure (PDB 9MDS), community evaluation, and exploration of lattice-based methods on non-protein biopolymers. Files included ROOL_env120_fragment_E8_prediction.pdb — predicted structure of the ~900-nt fragment