Profiling Argonaute-bound miRNAs and pre-miRNAs from Mouse Embryonic Fibroblasts

To Profile Argonaute-bound miRNAs and pre-miRNAs, 5'-end radiolabeled RNAs from anti-Ago IPs were resolved on a 10% denaturing PAGE gel. Gel slices containing 20-30 nt (miRNAs) and 50-80 nt (pre-miRNAs) RNAs were recovered. The eluted RNAs were ligated to the miRCat 3' Linker (IDT) using Truncated T4 RNA Ligase 2 (NEB) supplemented with 20% PEG6000 at room temperature for 3-4 hr. Ligation products were gel purified and reverse transcribed with RT primer (pGATCGTCGGACTGTAGAACTCT/idSp/CAAGCAGAAGACGGCATACGAATTGATG-GTGCCTACAG; p, phosphorylation; /idSp/, 1',2'-Dideoxyribose) using Affinityscript Reverse Transcriptase (Stratagene) at 55 °C for 60 min. The RT products were separated on a 10% denaturing PAGE gel and gel slices containing miRNAs and pre-miRNAs were recovered. The eluted cDNAs were circularized with CircLigase (EPICENTRE) at 60 °C for 60 min and then relinearized with APE 1 (NEB) at 37 °C for 90 min. 1 ul of the relinearized products were amplified with small RNA PCR Primer 1 (5'- CAAGCAGAAGACGGCATA) and Primer 2 (5'-AATGATACGGCGACCACCGACAGGTTC-AGAGTTCTACAGTCCGACG) using Phusion DNA polymerase (NEB) using the following PCR program: 95 °C for 30 sec, 20-25 cycles (95 °C for 10 sec, 60 °C for 10 sec, 72 °C for 5 sec). Then, 2 ul of 1st PCR products were re-amplified as above for another 8-16 cycles. The resulting PCR products were separated on a 3% MetaPhor (Lonza) agarose gel. The gel slices containing 100-120 nt (miRNAs) and 130-175 nt (pre-miRNAs) DNAs were recovered and purified with MinElute Gel Extraction Kit (Qiagen). The miRNA, WT pre-miRNA and D2A pre-miRNA libraries were sequenced from their 5’ ends for 101 nts using Genome Analyzer II (Illumina).