Manipulation of Mir140 3p and 5p expression

The goal of this study was to change the stoichiometry of Mir140-3p and Mir140-5p expression, thereby increasing the expression levels of Mir140-5p, and observe the biological effects on skeletal development. This was done by introducing two types of nucleotide changes into the seed regions of Mir140. The first was by changing the initial bases of Mir140-3p from 'TACCACAGGGTAGAACCACGGACAGGGTACTGGAGC' to 'CGCCACAGGGTAGAACCACGGACAGGGTACTGGAGC' lowering the expression levels of Mir140 3p and disrupting its function. The second change to alter Mir140 expression was by changing the Mir140-5p seed region from 'CAGTGGTTTTACCCTATGGAGG' to 'TAGTGGTTTTACCCTATGGAGG' increasing mi140-5p's ability to be bound by Argonaute. Overall design: Chondrocyte mRNA profiles of 10-day old wild type (WT) and Mir140 5p overexpressing mice produced by two different mutations were generated by deep sequencing, in duplicate, using DNBSEQ. CG WT - wildtype for the CG mutants CG CG - mutant mice with 3p seed region mutation C>T CT - mice with a C>T base change C>T WT - wildtype group for the C>T mutant mice